Incidental Mutation 'R6306:Slc5a4b'
ID 509678
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Name solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms SGLT3b, pSGLT2, 2010104G07Rik, SAAT1
MMRRC Submission 044468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6306 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 75894452-75946852 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75917185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 284 (T284A)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
AlphaFold Q91ZP4
Predicted Effect probably benign
Transcript: ENSMUST00000120757
AA Change: T284A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: T284A

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124320
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 G A 9: 90,060,331 (GRCm39) probably null Het
Adora2a T A 10: 75,169,238 (GRCm39) V234E probably damaging Het
Alpk1 T C 3: 127,479,965 (GRCm39) D188G probably damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Ankrd17 A G 5: 90,392,013 (GRCm39) F1886L probably benign Het
Anks1 T G 17: 28,269,613 (GRCm39) L769R probably damaging Het
Apol10a A G 15: 77,373,161 (GRCm39) I266V probably benign Het
Arhgef28 T C 13: 98,121,896 (GRCm39) Y556C probably damaging Het
Brd8 T A 18: 34,744,304 (GRCm39) T175S probably damaging Het
Camsap2 C T 1: 136,208,937 (GRCm39) V852I probably benign Het
Cd55b G T 1: 130,341,803 (GRCm39) P278Q probably damaging Het
Cep290 T A 10: 100,367,028 (GRCm39) S1126R possibly damaging Het
Cfh C T 1: 140,030,155 (GRCm39) C906Y probably damaging Het
Chst13 C A 6: 90,286,260 (GRCm39) R234L probably damaging Het
Clcn7 T C 17: 25,376,502 (GRCm39) F611L probably benign Het
Cntnap1 A G 11: 101,075,441 (GRCm39) D873G probably damaging Het
Cntnap5b T C 1: 100,091,871 (GRCm39) I518T probably damaging Het
Col28a1 T C 6: 8,014,969 (GRCm39) E812G probably damaging Het
Cpa1 T C 6: 30,640,953 (GRCm39) I148T probably damaging Het
Cyp11a1 A G 9: 57,932,383 (GRCm39) N232S probably benign Het
Dhrs13 A G 11: 77,923,519 (GRCm39) D79G probably damaging Het
Disp1 T C 1: 182,868,712 (GRCm39) E1236G possibly damaging Het
Dnah1 A C 14: 31,026,544 (GRCm39) L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,412,589 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dock9 A T 14: 121,799,492 (GRCm39) I1729N probably damaging Het
Dysf T C 6: 84,114,248 (GRCm39) V1192A possibly damaging Het
Enpp2 A G 15: 54,762,742 (GRCm39) S169P probably damaging Het
Fam114a2 T G 11: 57,404,972 (GRCm39) R43S probably damaging Het
Fam13a T C 6: 58,917,239 (GRCm39) T546A probably benign Het
Fos A T 12: 85,522,460 (GRCm39) D163V probably damaging Het
Fras1 T C 5: 96,912,805 (GRCm39) Y3370H probably damaging Het
Fshr T C 17: 89,507,961 (GRCm39) N27S probably null Het
Galnt6 A G 15: 100,591,305 (GRCm39) S600P possibly damaging Het
Gars1 T A 6: 55,032,809 (GRCm39) N260K probably damaging Het
Gpr158 C G 2: 21,820,422 (GRCm39) P640A possibly damaging Het
Grep1 T C 17: 23,925,124 (GRCm39) N495S possibly damaging Het
Grik3 A G 4: 125,526,205 (GRCm39) D146G probably benign Het
Hdac4 T C 1: 91,923,896 (GRCm39) T205A probably benign Het
Kcnq3 T C 15: 65,876,643 (GRCm39) D500G probably benign Het
Kmt5c A G 7: 4,749,480 (GRCm39) K333E probably benign Het
Krt81 A G 15: 101,357,404 (GRCm39) S443P probably benign Het
M6pr T C 6: 122,292,121 (GRCm39) probably null Het
Mccc2 T A 13: 100,130,085 (GRCm39) I91L probably benign Het
Nip7 A G 8: 107,785,055 (GRCm39) D110G probably damaging Het
Nol8 T A 13: 49,829,829 (GRCm39) F1093I probably damaging Het
Nrxn1 T C 17: 90,872,874 (GRCm39) T1027A possibly damaging Het
Ofcc1 T A 13: 40,302,052 (GRCm39) M495L probably benign Het
Or13p10 A T 4: 118,523,490 (GRCm39) M259L probably benign Het
Or7e178 A G 9: 20,225,742 (GRCm39) M158T probably benign Het
Pafah1b2 A T 9: 45,886,425 (GRCm39) V81D probably damaging Het
Pcdhga4 A T 18: 37,818,966 (GRCm39) S172C probably damaging Het
Pds5a A G 5: 65,813,639 (GRCm39) V282A probably damaging Het
Plat A G 8: 23,262,282 (GRCm39) D102G possibly damaging Het
Plce1 C A 19: 38,757,909 (GRCm39) Q1961K probably damaging Het
Plppr3 T A 10: 79,697,566 (GRCm39) K444* probably null Het
Plscr3 A G 11: 69,738,472 (GRCm39) probably null Het
Prtg A T 9: 72,813,468 (GRCm39) T943S probably benign Het
Racgap1 A G 15: 99,521,834 (GRCm39) F519L probably benign Het
Rbms2 A T 10: 127,987,050 (GRCm39) probably null Het
Rfx7 A G 9: 72,524,237 (GRCm39) T476A possibly damaging Het
Rnf150 T A 8: 83,810,131 (GRCm39) L421Q possibly damaging Het
Sema3b A G 9: 107,478,119 (GRCm39) L422P possibly damaging Het
Shank2 G A 7: 143,963,417 (GRCm39) A921T probably benign Het
Skint3 A T 4: 112,113,072 (GRCm39) E227D probably damaging Het
Slc25a19 G A 11: 115,508,386 (GRCm39) R201C possibly damaging Het
Slc38a10 G T 11: 120,038,645 (GRCm39) A40D probably damaging Het
Smc1b A T 15: 85,011,824 (GRCm39) F154I probably benign Het
Spry2 A T 14: 106,130,418 (GRCm39) M256K possibly damaging Het
Stkld1 C T 2: 26,833,899 (GRCm39) P129S probably damaging Het
Syce2 T C 8: 85,599,371 (GRCm39) L13S possibly damaging Het
Tbc1d15 C A 10: 115,069,148 (GRCm39) V74L possibly damaging Het
Tecpr2 T A 12: 110,911,185 (GRCm39) V1074D probably damaging Het
Tex36 G A 7: 133,197,054 (GRCm39) T21I probably benign Het
Ttn T G 2: 76,554,454 (GRCm39) D30787A probably damaging Het
Ttn T A 2: 76,622,264 (GRCm39) Q13710L probably benign Het
Usp34 T C 11: 23,362,260 (GRCm39) F1569L possibly damaging Het
Vat1l C T 8: 115,098,391 (GRCm39) A387V probably damaging Het
Vil1 G A 1: 74,460,470 (GRCm39) G209D possibly damaging Het
Vmn1r113 G T 7: 20,521,792 (GRCm39) D195Y probably damaging Het
Vmn2r69 A C 7: 85,064,799 (GRCm39) I29R probably benign Het
Vti1b G A 12: 79,207,323 (GRCm39) Q76* probably null Het
Zfp423 C A 8: 88,508,662 (GRCm39) V540F possibly damaging Het
Zfp644 T C 5: 106,785,990 (GRCm39) N186D probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp787 G A 7: 6,135,360 (GRCm39) A297V probably damaging Het
Zfp827 G T 8: 79,787,324 (GRCm39) Q163H probably damaging Het
Zfp955b T A 17: 33,522,160 (GRCm39) V543E probably benign Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 75,906,422 (GRCm39) missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 75,906,329 (GRCm39) splice site probably benign
IGL01754:Slc5a4b APN 10 75,906,449 (GRCm39) missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 75,896,260 (GRCm39) missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 75,896,188 (GRCm39) missense probably benign 0.01
IGL02211:Slc5a4b APN 10 75,896,297 (GRCm39) splice site probably benign
IGL02254:Slc5a4b APN 10 75,896,264 (GRCm39) missense probably benign
IGL02389:Slc5a4b APN 10 75,908,299 (GRCm39) nonsense probably null
IGL02427:Slc5a4b APN 10 75,894,713 (GRCm39) missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 75,910,849 (GRCm39) missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 75,946,685 (GRCm39) missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 75,910,934 (GRCm39) missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 75,906,462 (GRCm39) missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 75,898,117 (GRCm39) missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 75,917,161 (GRCm39) missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 75,926,534 (GRCm39) missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 75,899,870 (GRCm39) missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 75,917,341 (GRCm39) missense probably benign 0.09
R0975:Slc5a4b UTSW 10 75,917,241 (GRCm39) missense probably benign 0.09
R1934:Slc5a4b UTSW 10 75,917,307 (GRCm39) missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 75,944,383 (GRCm39) missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 75,910,907 (GRCm39) missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 75,917,358 (GRCm39) missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 75,898,094 (GRCm39) missense probably benign 0.01
R4012:Slc5a4b UTSW 10 75,910,826 (GRCm39) missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 75,894,725 (GRCm39) nonsense probably null
R4667:Slc5a4b UTSW 10 75,910,879 (GRCm39) missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 75,898,073 (GRCm39) missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 75,917,301 (GRCm39) missense probably benign 0.44
R5181:Slc5a4b UTSW 10 75,896,221 (GRCm39) nonsense probably null
R5319:Slc5a4b UTSW 10 75,898,233 (GRCm39) missense probably benign 0.08
R6422:Slc5a4b UTSW 10 75,939,696 (GRCm39) missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 75,898,220 (GRCm39) missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 75,925,812 (GRCm39) missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 75,910,943 (GRCm39) missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 75,946,742 (GRCm39) missense probably benign 0.01
R7683:Slc5a4b UTSW 10 75,899,906 (GRCm39) missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 75,906,407 (GRCm39) missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 75,898,133 (GRCm39) missense probably benign 0.19
R7877:Slc5a4b UTSW 10 75,910,886 (GRCm39) missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 75,939,680 (GRCm39) missense possibly damaging 0.93
R8843:Slc5a4b UTSW 10 75,910,925 (GRCm39) missense probably damaging 1.00
R9111:Slc5a4b UTSW 10 75,925,827 (GRCm39) splice site probably benign
R9163:Slc5a4b UTSW 10 75,917,165 (GRCm39) nonsense probably null
R9195:Slc5a4b UTSW 10 75,898,149 (GRCm39) missense probably damaging 1.00
R9600:Slc5a4b UTSW 10 75,896,239 (GRCm39) missense probably damaging 1.00
R9643:Slc5a4b UTSW 10 75,945,896 (GRCm39) missense probably benign 0.01
R9656:Slc5a4b UTSW 10 75,944,391 (GRCm39) missense probably damaging 0.98
R9699:Slc5a4b UTSW 10 75,946,674 (GRCm39) missense probably damaging 0.99
X0019:Slc5a4b UTSW 10 75,946,685 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGAGCTGAATGTGTCTCTGAGG -3'
(R):5'- CATTTGCTGAAGTCGGAGGC -3'

Sequencing Primer
(F):5'- TGGGGGACACAGTGTGC -3'
(R):5'- CTACGAGAGCTTTACCGAGAAG -3'
Posted On 2018-04-02