Mutagenetix > Incidental Mutation

Incidental Mutation 'R6306:Usp34'

509683

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R6306 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23412260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1569 (F1569L)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: F1588L

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: F1588L

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155984

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180046
AA Change: F1569L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: F1569L

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.2861

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (88/88)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	T	C	17: 23,706,150	N495S	possibly damaging	Het
Adamts7	G	A	9: 90,178,278		probably null	Het
Adora2a	T	A	10: 75,333,404	V234E	probably damaging	Het
Alpk1	T	C	3: 127,686,316	D188G	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Ankrd17	A	G	5: 90,244,154	F1886L	probably benign	Het
Anks1	T	G	17: 28,050,639	L769R	probably damaging	Het
Apol10a	A	G	15: 77,488,961	I266V	probably benign	Het
Arhgef28	T	C	13: 97,985,388	Y556C	probably damaging	Het
Brd8	T	A	18: 34,611,251	T175S	probably damaging	Het
Camsap2	C	T	1: 136,281,199	V852I	probably benign	Het
Cd55b	G	T	1: 130,414,066	P278Q	probably damaging	Het
Cep290	T	A	10: 100,531,166	S1126R	possibly damaging	Het
Cfh	C	T	1: 140,102,417	C906Y	probably damaging	Het
Chst13	C	A	6: 90,309,278	R234L	probably damaging	Het
Clcn7	T	C	17: 25,157,528	F611L	probably benign	Het
Cntnap1	A	G	11: 101,184,615	D873G	probably damaging	Het
Cntnap5b	T	C	1: 100,164,146	I518T	probably damaging	Het
Col28a1	T	C	6: 8,014,969	E812G	probably damaging	Het
Cpa1	T	C	6: 30,640,954	I148T	probably damaging	Het
Cyp11a1	A	G	9: 58,025,100	N232S	probably benign	Het
Dhrs13	A	G	11: 78,032,693	D79G	probably damaging	Het
Disp1	T	C	1: 183,087,148	E1236G	possibly damaging	Het
Dnah1	A	C	14: 31,304,587	L778R	probably damaging	Het
Dnah14	CTGTG	CTG	1: 181,585,024		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dock9	A	T	14: 121,562,080	I1729N	probably damaging	Het
Dysf	T	C	6: 84,137,266	V1192A	possibly damaging	Het
Enpp2	A	G	15: 54,899,346	S169P	probably damaging	Het
Fam114a2	T	G	11: 57,514,146	R43S	probably damaging	Het
Fam13a	T	C	6: 58,940,254	T546A	probably benign	Het
Fos	A	T	12: 85,475,686	D163V	probably damaging	Het
Fras1	T	C	5: 96,764,946	Y3370H	probably damaging	Het
Fshr	T	C	17: 89,200,533	N27S	probably null	Het
Galnt6	A	G	15: 100,693,424	S600P	possibly damaging	Het
Gars	T	A	6: 55,055,824	N260K	probably damaging	Het
Gpr158	C	G	2: 21,815,611	P640A	possibly damaging	Het
Grik3	A	G	4: 125,632,412	D146G	probably benign	Het
Hdac4	T	C	1: 91,996,174	T205A	probably benign	Het
Kcnq3	T	C	15: 66,004,794	D500G	probably benign	Het
Kmt5c	A	G	7: 4,746,481	K333E	probably benign	Het
Krt81	A	G	15: 101,459,523	S443P	probably benign	Het
M6pr	T	C	6: 122,315,162		probably null	Het
Mccc2	T	A	13: 99,993,577	I91L	probably benign	Het
Nip7	A	G	8: 107,058,423	D110G	probably damaging	Het
Nol8	T	A	13: 49,676,353	F1093I	probably damaging	Het
Nrxn1	T	C	17: 90,565,446	T1027A	possibly damaging	Het
Ofcc1	T	A	13: 40,148,576	M495L	probably benign	Het
Olfr18	A	G	9: 20,314,446	M158T	probably benign	Het
Olfr62	A	T	4: 118,666,293	M259L	probably benign	Het
Pafah1b2	A	T	9: 45,975,127	V81D	probably damaging	Het
Pcdhga4	A	T	18: 37,685,913	S172C	probably damaging	Het
Pds5a	A	G	5: 65,656,296	V282A	probably damaging	Het
Plat	A	G	8: 22,772,266	D102G	possibly damaging	Het
Plce1	C	A	19: 38,769,465	Q1961K	probably damaging	Het
Plppr3	T	A	10: 79,861,732	K444*	probably null	Het
Plscr3	A	G	11: 69,847,646		probably null	Het
Prtg	A	T	9: 72,906,186	T943S	probably benign	Het
Racgap1	A	G	15: 99,623,953	F519L	probably benign	Het
Rbms2	A	T	10: 128,151,181		probably null	Het
Rfx7	A	G	9: 72,616,955	T476A	possibly damaging	Het
Rnf150	T	A	8: 83,083,502	L421Q	possibly damaging	Het
Sema3b	A	G	9: 107,600,920	L422P	possibly damaging	Het
Shank2	G	A	7: 144,409,680	A921T	probably benign	Het
Skint3	A	T	4: 112,255,875	E227D	probably damaging	Het
Slc25a19	G	A	11: 115,617,560	R201C	possibly damaging	Het
Slc38a10	G	T	11: 120,147,819	A40D	probably damaging	Het
Slc5a4b	T	C	10: 76,081,351	T284A	probably benign	Het
Smc1b	A	T	15: 85,127,623	F154I	probably benign	Het
Spry2	A	T	14: 105,892,984	M256K	possibly damaging	Het
Stkld1	C	T	2: 26,943,887	P129S	probably damaging	Het
Syce2	T	C	8: 84,872,742	L13S	possibly damaging	Het
Tbc1d15	C	A	10: 115,233,243	V74L	possibly damaging	Het
Tecpr2	T	A	12: 110,944,751	V1074D	probably damaging	Het
Tex36	G	A	7: 133,595,325	T21I	probably benign	Het
Ttn	T	G	2: 76,724,110	D30787A	probably damaging	Het
Ttn	T	A	2: 76,791,920	Q13710L	probably benign	Het
Vat1l	C	T	8: 114,371,651	A387V	probably damaging	Het
Vil1	G	A	1: 74,421,311	G209D	possibly damaging	Het
Vmn1r113	G	T	7: 20,787,867	D195Y	probably damaging	Het
Vmn2r69	A	C	7: 85,415,591	I29R	probably benign	Het
Vti1b	G	A	12: 79,160,549	Q76*	probably null	Het
Zfp423	C	A	8: 87,782,034	V540F	possibly damaging	Het
Zfp644	T	C	5: 106,638,124	N186D	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp787	G	A	7: 6,132,361	A297V	probably damaging	Het
Zfp827	G	T	8: 79,060,695	Q163H	probably damaging	Het
Zfp955b	T	A	17: 33,303,186	V543E	probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCATGTAGCACATTGATGAGAATC -3'
(R):5'- TGGCTGGTAGGAAGTATCATAGGAATC -3'

Sequencing Primer
(F):5'- GTAGCACATTGATGAGAATCTACCC -3'
(R):5'- ATTTTCCAGGCCAGGTTC -3'

Posted On

2018-04-02