Incidental Mutation 'R6306:Nrxn1'
ID509712
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Nameneurexin I
Synonymsneurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location90033631-91093071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90565446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1027 (T1027A)
Ref Sequence ENSEMBL: ENSMUSP00000072458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000174331] [ENSMUST00000176118]
Predicted Effect probably benign
Transcript: ENSMUST00000054059
AA Change: T1027A

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109
AA Change: T1027A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072671
AA Change: T1027A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109
AA Change: T1027A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160800
AA Change: T1023A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109
AA Change: T1023A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160844
AA Change: T1035A

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109
AA Change: T1035A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161102
Predicted Effect probably benign
Transcript: ENSMUST00000161402
AA Change: T1042A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109
AA Change: T1042A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161637
Predicted Effect probably benign
Transcript: ENSMUST00000174331
AA Change: T1035A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109
AA Change: T1035A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175818
Predicted Effect probably benign
Transcript: ENSMUST00000176118
AA Change: T69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135241
Gene: ENSMUSG00000024109
AA Change: T69A

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 95 3.1e-18 PFAM
Pfam:Laminin_G_1 1 98 3.7e-12 PFAM
EGF 129 163 1.87e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196559
AA Change: T19A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 unclassified probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90597579 missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90455503 intron probably benign
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90455049 missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90037136 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90362906 missense possibly damaging 0.64
R7570:Nrxn1 UTSW 17 90162379 missense probably benign 0.35
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCAGAAATTTTGCTGGC -3'
(R):5'- TTTTCCTTAGGTGACACCCTAG -3'

Sequencing Primer
(F):5'- AGCAGAAATTTTGCTGGCTGGTG -3'
(R):5'- AGCATCTAGAAAAATGTCAGTGC -3'
Posted On2018-04-02