Incidental Mutation 'R6309:Abcg3'
ID509726
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene NameATP binding cassette subfamily G member 3
SynonymsMxr2, Abcp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104935057-104982718 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 104969393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
Predicted Effect probably null
Transcript: ENSMUST00000031239
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130644
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197004
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4242:Abcg3 UTSW 5 104961213 missense probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5309:Abcg3 UTSW 5 104936599 missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6872:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
R7531:Abcg3 UTSW 5 104977641 missense probably benign
R7685:Abcg3 UTSW 5 104968215 missense probably damaging 1.00
R7728:Abcg3 UTSW 5 104936078 missense probably benign 0.00
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTCACATGCTTGAGGG -3'
(R):5'- GCTAGTTCACCAAACGATAATGAC -3'

Sequencing Primer
(F):5'- ACATTCTATTTAAACAGTGCTCCACC -3'
(R):5'- TCACCAAACGATAATGACTATGTTC -3'
Posted On2018-04-02