Incidental Mutation 'R6309:Wdr95'
ID509727
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene NameWD40 repeat domain 95
Synonyms4930434E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149528679-149611894 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 149580803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902]
Predicted Effect probably null
Transcript: ENSMUST00000110502
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202635
Predicted Effect probably null
Transcript: ENSMUST00000202902
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149595244 critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149596321 missense probably benign 0.02
IGL03078:Wdr95 APN 5 149611597 missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149581887 splice site probably null
P0037:Wdr95 UTSW 5 149588071 missense probably benign 0.27
R0115:Wdr95 UTSW 5 149564390 missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149580806 missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149588130 missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149574048 missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149606337 missense probably benign 0.00
R1233:Wdr95 UTSW 5 149581858 missense possibly damaging 0.61
R1233:Wdr95 UTSW 5 149595364 missense probably benign 0.00
R1344:Wdr95 UTSW 5 149588098 missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149599294 missense probably benign 0.00
R1623:Wdr95 UTSW 5 149574116 missense probably damaging 1.00
R1633:Wdr95 UTSW 5 149593172 missense probably damaging 0.98
R1664:Wdr95 UTSW 5 149595287 missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149593101 missense probably damaging 1.00
R1741:Wdr95 UTSW 5 149595396 splice site probably null
R1750:Wdr95 UTSW 5 149581886 splice site probably null
R1774:Wdr95 UTSW 5 149564392 nonsense probably null
R1831:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R1838:Wdr95 UTSW 5 149599366 missense probably benign 0.00
R1907:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149574148 splice site probably benign
R2063:Wdr95 UTSW 5 149579162 splice site probably null
R2392:Wdr95 UTSW 5 149580670 missense probably benign 0.03
R2863:Wdr95 UTSW 5 149581856 nonsense probably null
R4116:Wdr95 UTSW 5 149597575 missense probably benign 0.02
R4237:Wdr95 UTSW 5 149563337 nonsense probably null
R4420:Wdr95 UTSW 5 149532666 missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149581814 splice site probably benign
R4824:Wdr95 UTSW 5 149595332 missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149611692 nonsense probably null
R5016:Wdr95 UTSW 5 149544801 missense probably benign 0.00
R5458:Wdr95 UTSW 5 149564414 missense probably damaging 1.00
R5486:Wdr95 UTSW 5 149596330 nonsense probably null
R5613:Wdr95 UTSW 5 149584470 missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149564227 missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149594482 missense probably benign 0.00
R6867:Wdr95 UTSW 5 149580923 splice site probably null
R6964:Wdr95 UTSW 5 149581850 missense probably damaging 1.00
R7008:Wdr95 UTSW 5 149611540 missense probably benign 0.00
R7208:Wdr95 UTSW 5 149595371 missense probably benign 0.02
R7309:Wdr95 UTSW 5 149606293 missense probably benign 0.01
R7504:Wdr95 UTSW 5 149581846 missense probably damaging 0.99
R7660:Wdr95 UTSW 5 149594480 missense possibly damaging 0.86
R7997:Wdr95 UTSW 5 149579157 critical splice donor site probably null
R8084:Wdr95 UTSW 5 149588133 missense probably damaging 1.00
R8356:Wdr95 UTSW 5 149579107 missense probably damaging 1.00
R8456:Wdr95 UTSW 5 149579107 missense probably damaging 1.00
R8523:Wdr95 UTSW 5 149573996 missense probably damaging 1.00
R8682:Wdr95 UTSW 5 149595287 missense possibly damaging 0.94
X0024:Wdr95 UTSW 5 149588167 missense possibly damaging 0.81
Z1176:Wdr95 UTSW 5 149566436 missense probably benign 0.34
Z1177:Wdr95 UTSW 5 149544776 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCCATCTTTCCTGCAAC -3'
(R):5'- TGCGAGGCACGATTTTACTTG -3'

Sequencing Primer
(F):5'- CCTGCAACTTTGATACAGGTAGTG -3'
(R):5'- GGCACGATTTTACTTGATTCATTTC -3'
Posted On2018-04-02