Incidental Mutation 'R6309:Slc37a3'
ID509729
Institutional Source Beutler Lab
Gene Symbol Slc37a3
Ensembl Gene ENSMUSG00000029924
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location39334773-39377675 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 39357460 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 84 (*84W)
Ref Sequence ENSEMBL: ENSMUSP00000144636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090243] [ENSMUST00000200771] [ENSMUST00000200961] [ENSMUST00000200969] [ENSMUST00000201448] [ENSMUST00000202204] [ENSMUST00000202400] [ENSMUST00000202749]
Predicted Effect probably benign
Transcript: ENSMUST00000090243
AA Change: I105M

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087709
Gene: ENSMUSG00000029924
AA Change: I105M

DomainStartEndE-ValueType
Pfam:MFS_1 23 420 3.8e-37 PFAM
Pfam:Sugar_tr 27 262 2.5e-8 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200771
SMART Domains Protein: ENSMUSP00000143953
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200961
AA Change: I105M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144562
Gene: ENSMUSG00000029924
AA Change: I105M

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200969
SMART Domains Protein: ENSMUSP00000144244
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201448
AA Change: I105M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144059
Gene: ENSMUSG00000029924
AA Change: I105M

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202204
SMART Domains Protein: ENSMUSP00000144316
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202400
AA Change: I105M

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144557
Gene: ENSMUSG00000029924
AA Change: I105M

DomainStartEndE-ValueType
Pfam:MFS_1 12 173 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202749
AA Change: *84W
SMART Domains Protein: ENSMUSP00000144636
Gene: ENSMUSG00000029924
AA Change: *84W

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Slc37a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Slc37a3 APN 6 39337262 missense probably damaging 1.00
IGL02447:Slc37a3 APN 6 39337195 missense probably benign 0.00
IGL03017:Slc37a3 APN 6 39349381 missense probably benign 0.13
IGL03142:Slc37a3 APN 6 39359985 splice site probably null
IGL03164:Slc37a3 APN 6 39345303 missense probably benign 0.02
R0240:Slc37a3 UTSW 6 39337238 missense probably benign 0.02
R0551:Slc37a3 UTSW 6 39352754 unclassified probably benign
R1453:Slc37a3 UTSW 6 39366943 missense probably damaging 1.00
R1866:Slc37a3 UTSW 6 39359968 missense probably damaging 1.00
R2242:Slc37a3 UTSW 6 39338805 missense probably benign 0.00
R4410:Slc37a3 UTSW 6 39338813 missense probably benign
R4784:Slc37a3 UTSW 6 39337223 missense probably benign 0.12
R4983:Slc37a3 UTSW 6 39352717 nonsense probably null
R5543:Slc37a3 UTSW 6 39355026 missense probably damaging 1.00
R7849:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7872:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R7932:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7955:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R8062:Slc37a3 UTSW 6 39364596 missense probably damaging 1.00
Z1177:Slc37a3 UTSW 6 39350076 missense possibly damaging 0.92
Z1177:Slc37a3 UTSW 6 39355011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGGTCAAAAGAGCATTAACTG -3'
(R):5'- CTGAAGCACTGACATTCATAGACAG -3'

Sequencing Primer
(F):5'- GTCTCTCTCCACAGTGTGATCAGAG -3'
(R):5'- TCCCAGCGTAGACTGTTA -3'
Posted On2018-04-02