Mutagenetix > Incidental Mutation

Incidental Mutation 'R6309:Lrrn3'

509739

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R6309 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41453206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 371 (R371C)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000043884
AA Change: R371C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: R371C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

92% (35/38)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,969,393		probably null	Het
Ak4	T	C	4: 101,463,662	Y223H	probably benign	Het
Armc4	A	G	18: 7,214,617	V728A	probably benign	Het
Cerk	T	C	15: 86,156,668		probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Col18a1	A	G	10: 77,112,742		probably benign	Het
Cpeb3	T	G	19: 37,044,689	I569L	possibly damaging	Het
Dis3	A	T	14: 99,085,922	N569K	probably benign	Het
Erich5	T	C	15: 34,471,456	L277P	probably benign	Het
Fam171b	T	C	2: 83,860,460	S256P	probably damaging	Het
Glis3	A	G	19: 28,317,361	V679A	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm8212	A	G	14: 44,201,179		probably benign	Het
Grin2b	T	A	6: 135,733,027	T1174S	probably benign	Het
Hipk2	T	C	6: 38,698,511	Y1045C	probably damaging	Het
Hsf2	C	T	10: 57,486,580		probably benign	Het
Ighv1-4	G	T	12: 114,487,395	A31E	probably benign	Het
Il11ra1	A	G	4: 41,765,279	K151E	possibly damaging	Het
Inpp4b	T	A	8: 82,041,917	M685K	probably damaging	Het
Itga4	T	A	2: 79,279,085	D209E	probably damaging	Het
L1td1	T	C	4: 98,737,091	S508P	probably damaging	Het
Nbeal1	A	G	1: 60,238,719	T755A	probably benign	Het
Olfr129	T	A	17: 38,055,152	Y138F	probably damaging	Het
Olfr134	T	C	17: 38,175,519	V145A	probably benign	Het
Phf24	A	G	4: 42,933,960	D14G	probably damaging	Het
Prkd1	A	T	12: 50,394,660	C314*	probably null	Het
Rnf187	A	T	11: 58,937,160	S155T	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Homo
Scn10a	A	G	9: 119,624,115	I1237T	possibly damaging	Het
Sec16a	T	C	2: 26,438,571	N1144S	probably benign	Het
Sh3tc2	T	C	18: 61,968,010	V58A	probably damaging	Het
Slc37a3	T	C	6: 39,357,460	*84W	probably null	Het
Trpm2	T	A	10: 77,938,368	I466F	probably damaging	Het
Vmn2r108	T	A	17: 20,471,398	I288F	probably damaging	Het
Vmn2r67	T	C	7: 85,151,916	T271A	probably benign	Het
Vsig10l	A	G	7: 43,470,973		probably null	Het
Wdr95	A	G	5: 149,580,803		probably null	Het
Zfp960	T	C	17: 17,088,377	I451T	probably benign	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCTACATCCAGGTCAGAAGG -3'
(R):5'- TCGCTGTGGATAACTTGCCAG -3'

Sequencing Primer
(F):5'- TCCAGGTCAGAAGGAAAGCTCTC -3'
(R):5'- CTGTGGATAACTTGCCAGATTTGAG -3'

Posted On

2018-04-02