Incidental Mutation 'R6309:Prkd1'
ID509740
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Nameprotein kinase D1
SynonymsPrkcm, Pkcm, PKD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location50341231-50649098 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 50394660 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 314 (C314*)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
Predicted Effect probably null
Transcript: ENSMUST00000002765
AA Change: C314*
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: C314*

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50383481 missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50364661 missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50383416 missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50383515 splice site probably benign
IGL01457:Prkd1 APN 12 50392910 nonsense probably null
IGL01538:Prkd1 APN 12 50342142 missense probably benign
IGL01762:Prkd1 APN 12 50387230 missense probably benign 0.00
IGL01876:Prkd1 APN 12 50366348 missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50366379 missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50387263 missense probably benign
IGL02293:Prkd1 APN 12 50489978 missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50364673 missense probably benign 0.09
IGL03309:Prkd1 APN 12 50388424 missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50366356 missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50366372 missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50490041 missense probably benign 0.00
R0899:Prkd1 UTSW 12 50385193 missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50388342 missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50366352 missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50425515 missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50342039 missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50394994 missense probably benign 0.00
R2143:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50648904 missense unknown
R3801:Prkd1 UTSW 12 50383422 missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50419884 splice site probably benign
R3906:Prkd1 UTSW 12 50388426 missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50392941 missense probably benign 0.44
R4179:Prkd1 UTSW 12 50366448 missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50419848 splice site probably null
R4896:Prkd1 UTSW 12 50389962 missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50394622 nonsense probably null
R5263:Prkd1 UTSW 12 50388306 missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50343137 missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50391432 missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50392916 missense probably benign 0.03
R5967:Prkd1 UTSW 12 50364550 missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50388255 missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50366300 critical splice donor site probably null
R6063:Prkd1 UTSW 12 50342043 missense probably benign 0.02
R6518:Prkd1 UTSW 12 50425495 missense probably benign 0.08
R6868:Prkd1 UTSW 12 50425537 missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50388342 missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50648834 missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50425517 missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50342016 missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50392892 missense probably benign
X0024:Prkd1 UTSW 12 50489974 missense probably benign 0.31
X0062:Prkd1 UTSW 12 50394922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCACTGTTTATTCAGAGCTG -3'
(R):5'- TAAGAAGCTCCTCAAGGGCC -3'

Sequencing Primer
(F):5'- CCACTGTTTATTCAGAGCTGAGTTAC -3'
(R):5'- CGTGAATGAATGGAAGTTGC -3'
Posted On2018-04-02