Incidental Mutation 'R6309:Olfr129'
ID509747
Institutional Source Beutler Lab
Gene Symbol Olfr129
Ensembl Gene ENSMUSG00000081724
Gene Nameolfactory receptor 129
SynonymsGA_x6K02T2PSCP-2503741-2502776, MOR263-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location38050857-38060079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38055152 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 138 (Y138F)
Ref Sequence ENSEMBL: ENSMUSP00000149327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122318] [ENSMUST00000216476]
Predicted Effect probably damaging
Transcript: ENSMUST00000122318
AA Change: Y147F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113564
Gene: ENSMUSG00000081724
AA Change: Y147F

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 4.6e-56 PFAM
Pfam:7TM_GPCR_Srsx 50 319 1.1e-5 PFAM
Pfam:7tm_1 56 305 3.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216476
AA Change: Y138F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2934 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Olfr129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr129 APN 17 38055590 start codon destroyed probably null 0.15
IGL02163:Olfr129 APN 17 38054750 missense probably benign 0.06
IGL02374:Olfr129 APN 17 38055521 missense probably damaging 1.00
R0840:Olfr129 UTSW 17 38055572 missense probably benign 0.00
R1774:Olfr129 UTSW 17 38055437 missense probably benign 0.00
R3720:Olfr129 UTSW 17 38055368 missense probably damaging 1.00
R3794:Olfr129 UTSW 17 38054895 missense probably damaging 1.00
R3840:Olfr129 UTSW 17 38055348 missense probably damaging 1.00
R4002:Olfr129 UTSW 17 38054988 missense probably damaging 1.00
R4273:Olfr129 UTSW 17 38055272 missense probably damaging 1.00
R4872:Olfr129 UTSW 17 38055576 missense probably benign
R5606:Olfr129 UTSW 17 38054802 missense probably damaging 0.98
R7269:Olfr129 UTSW 17 38055551 missense probably damaging 1.00
R7450:Olfr129 UTSW 17 38055109 missense probably benign 0.00
R7829:Olfr129 UTSW 17 38055329 missense possibly damaging 0.64
R8103:Olfr129 UTSW 17 38055012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATGGCAGCCTCATTTTG -3'
(R):5'- TCTCCTGGAGATTGGCTACAC -3'

Sequencing Primer
(F):5'- TGTATCTCCACAGGCAAGTG -3'
(R):5'- GCTACACTTGTACTGTCATACCGAAG -3'
Posted On2018-04-02