Incidental Mutation 'R6309:Cpeb3'
ID509752
Institutional Source Beutler Lab
Gene Symbol Cpeb3
Ensembl Gene ENSMUSG00000039652
Gene Namecytoplasmic polyadenylation element binding protein 3
Synonyms4831444O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37021291-37208601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37044689 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 569 (I569L)
Ref Sequence ENSEMBL: ENSMUSP00000116309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079754] [ENSMUST00000123727] [ENSMUST00000124158] [ENSMUST00000126188] [ENSMUST00000132580] [ENSMUST00000136286] [ENSMUST00000154376]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079754
AA Change: I586L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652
AA Change: I586L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123727
AA Change: I555L

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121987
Gene: ENSMUSG00000039652
AA Change: I555L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 429 501 2.01e-5 SMART
RRM 537 610 1e-2 SMART
PDB:2M13|A 611 676 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000124158
AA Change: I285L

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115656
Gene: ENSMUSG00000039652
AA Change: I285L

DomainStartEndE-ValueType
RRM 159 231 2.01e-5 SMART
RRM 267 340 1e-2 SMART
PDB:2M13|A 341 406 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126188
AA Change: I563L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652
AA Change: I563L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000132580
AA Change: I586L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652
AA Change: I586L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000136286
AA Change: I569L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652
AA Change: I569L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000154376
AA Change: I586L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116172
Gene: ENSMUSG00000039652
AA Change: I586L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased anxiety-related response, enhanced contextual conditioning behavior, abnormal spatial reference memory, hypoactivity and abnormal hippocampus pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Cpeb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Cpeb3 APN 19 37054295 missense probably damaging 1.00
IGL01402:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01404:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01702:Cpeb3 APN 19 37126382 missense possibly damaging 0.85
IGL01811:Cpeb3 APN 19 37044608 missense probably damaging 1.00
IGL03036:Cpeb3 APN 19 37024948 missense probably damaging 1.00
R0580:Cpeb3 UTSW 19 37174035 missense probably benign 0.02
R1463:Cpeb3 UTSW 19 37139100 missense probably benign 0.08
R1572:Cpeb3 UTSW 19 37139082 missense probably benign 0.38
R1914:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R1915:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R2031:Cpeb3 UTSW 19 37044679 missense probably damaging 1.00
R4296:Cpeb3 UTSW 19 37173989 missense possibly damaging 0.90
R4528:Cpeb3 UTSW 19 37139088 missense possibly damaging 0.85
R4607:Cpeb3 UTSW 19 37174839 missense possibly damaging 0.82
R4909:Cpeb3 UTSW 19 37174659 missense probably damaging 1.00
R4909:Cpeb3 UTSW 19 37174233 missense possibly damaging 0.63
R5240:Cpeb3 UTSW 19 37174515 missense probably damaging 0.99
R5985:Cpeb3 UTSW 19 37087552 missense probably damaging 1.00
R6179:Cpeb3 UTSW 19 37088453 missense probably damaging 1.00
R6768:Cpeb3 UTSW 19 37025032 missense possibly damaging 0.92
R6787:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R7102:Cpeb3 UTSW 19 37174719 missense probably benign
R7194:Cpeb3 UTSW 19 37174752 missense probably benign
R7422:Cpeb3 UTSW 19 37174500 missense probably benign 0.13
R7594:Cpeb3 UTSW 19 37174151 missense possibly damaging 0.70
R7630:Cpeb3 UTSW 19 37054293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGTTTGTCAATGTCGTTG -3'
(R):5'- TAGTTGTGACTGCATCGCC -3'

Sequencing Primer
(F):5'- TGTGTTGAAGTTGCACAAAGC -3'
(R):5'- CCCCCTGTGTACATACATGTAAATTG -3'
Posted On2018-04-02