Incidental Mutation 'R6311:Pgm2'
ID509766
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99970040 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 379 (F379S)
Ref Sequence ENSEMBL: ENSMUSP00000099844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058351
AA Change: F361S

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: F361S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102783
AA Change: F379S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791
AA Change: F379S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Meta Mutation Damage Score 0.8728 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense probably damaging 0.99
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGAACCCCTTGTGTCC -3'
(R):5'- TGTCTTGATTTAGGGCTCATCAGC -3'

Sequencing Primer
(F):5'- GAAGAACCCCTTGTGTCCAAGTTTC -3'
(R):5'- TGTTAGCATGAGTGCCAC -3'
Posted On2018-04-02