Incidental Mutation 'R6311:Sult2a3'
ID509772
Institutional Source Beutler Lab
Gene Symbol Sult2a3
Ensembl Gene ENSMUSG00000074375
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3
SynonymsGm6955
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location14067446-14123044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14111557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 126 (I126V)
Ref Sequence ENSEMBL: ENSMUSP00000096407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098809]
Predicted Effect probably benign
Transcript: ENSMUST00000098809
AA Change: I126V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096407
Gene: ENSMUSG00000074375
AA Change: I126V

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 1.5e-83 PFAM
Pfam:Sulfotransfer_3 35 205 3.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Sult2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Sult2a3 APN 7 14122980 missense probably benign 0.03
IGL02353:Sult2a3 APN 7 14121650 nonsense probably null
IGL02360:Sult2a3 APN 7 14121650 nonsense probably null
IGL02806:Sult2a3 APN 7 14122932 missense probably damaging 1.00
IGL03252:Sult2a3 APN 7 14067634 missense probably damaging 1.00
R0029:Sult2a3 UTSW 7 14073074 missense probably benign 0.11
R1480:Sult2a3 UTSW 7 14122911 missense possibly damaging 0.51
R1491:Sult2a3 UTSW 7 14122942 missense probably benign 0.01
R4078:Sult2a3 UTSW 7 14121737 missense possibly damaging 0.94
R4668:Sult2a3 UTSW 7 14122861 missense probably damaging 1.00
R4928:Sult2a3 UTSW 7 14111557 missense probably benign 0.06
R6749:Sult2a3 UTSW 7 14082704 missense probably benign 0.00
R7030:Sult2a3 UTSW 7 14067568 missense probably damaging 1.00
R7232:Sult2a3 UTSW 7 14082760 missense possibly damaging 0.89
R7394:Sult2a3 UTSW 7 14111524 missense probably benign 0.05
R7617:Sult2a3 UTSW 7 14073056 missense probably benign 0.00
R8029:Sult2a3 UTSW 7 14121628 missense probably damaging 1.00
R8097:Sult2a3 UTSW 7 14082710 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGCACCTATCCCTTCTCA -3'
(R):5'- AGAACTGTTGAATCAGTCTGTGTT -3'

Sequencing Primer
(F):5'- TATCCCTTCTCAGAGGAGCAGAG -3'
(R):5'- TGAACTAGTCATTTTGTTGTTCCAG -3'
Posted On2018-04-02