Incidental Mutation 'R6311:Lrriq1'
ID509779
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103173393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1076 (D1076E)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: D1076E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: D1076E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R7991:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACCTTACCTCTTCTGTGTGATATAC -3'
(R):5'- TGGCCCAAGTTTCTAACATTGG -3'

Sequencing Primer
(F):5'- CTCTTCTGTGTGATATACTTTTCAGG -3'
(R):5'- GGCCCAAGTTTCTAACATTGGTTCTC -3'
Posted On2018-04-02