Incidental Mutation 'R6311:Olfr812'
ID509780
Institutional Source Beutler Lab
Gene Symbol Olfr812
Ensembl Gene ENSMUSG00000049052
Gene Nameolfactory receptor 812
SynonymsGA_x6K02T2PULF-11521598-11520666, MOR110-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129841418-129846094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129842907 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000145482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057775
AA Change: L45P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: L45P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203571
AA Change: L45P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: L45P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205013
AA Change: L45P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: L45P

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Olfr812
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr812 APN 10 129842473 missense probably damaging 1.00
IGL01637:Olfr812 APN 10 129842610 missense probably benign 0.14
IGL02035:Olfr812 APN 10 129842790 missense possibly damaging 0.95
IGL02546:Olfr812 APN 10 129842547 missense probably damaging 0.97
R1902:Olfr812 UTSW 10 129842506 missense probably benign
R4583:Olfr812 UTSW 10 129842475 missense probably damaging 1.00
R4598:Olfr812 UTSW 10 129842995 missense possibly damaging 0.92
R4714:Olfr812 UTSW 10 129842945 missense probably damaging 0.99
R5196:Olfr812 UTSW 10 129842781 missense possibly damaging 0.90
R5953:Olfr812 UTSW 10 129842614 missense probably benign 0.22
R6356:Olfr812 UTSW 10 129842608 missense probably benign 0.14
R6499:Olfr812 UTSW 10 129842584 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTGGACCCTAGTAGGAATAC -3'
(R):5'- AGCACATGTTCATAGAAGGACATG -3'

Sequencing Primer
(F):5'- ATCAGGAACCTGGGAATG -3'
(R):5'- TGATGTCTAAAATAATTGCACATTGC -3'
Posted On2018-04-02