Incidental Mutation 'R6311:Fstl4'
ID509781
Institutional Source Beutler Lab
Gene Symbol Fstl4
Ensembl Gene ENSMUSG00000036264
Gene Namefollistatin-like 4
SynonymsSPIG1, B230374F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52764634-53188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53176977 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 556 (W556R)
Ref Sequence ENSEMBL: ENSMUSP00000042007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036796]
Predicted Effect probably damaging
Transcript: ENSMUST00000036796
AA Change: W556R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042007
Gene: ENSMUSG00000036264
AA Change: W556R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 87 132 4.7e-13 SMART
Blast:IG_like 215 241 6e-7 BLAST
IGc2 260 327 1.9e-6 SMART
IGc2 352 419 1e-14 SMART
Meta Mutation Damage Score 0.8655 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous null mice were born at expected Mendelian ratio and healthy, fertile, apparently normal with normal retinal laminar structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Fstl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fstl4 APN 11 53186275 missense probably benign 0.01
IGL00885:Fstl4 APN 11 53148982 missense possibly damaging 0.90
IGL00915:Fstl4 APN 11 53176998 missense probably benign
IGL00933:Fstl4 APN 11 53186761 missense possibly damaging 0.80
IGL01022:Fstl4 APN 11 53186741 missense probably benign 0.18
IGL01121:Fstl4 APN 11 52814637 missense probably benign 0.00
IGL01656:Fstl4 APN 11 53000374 missense probably damaging 1.00
IGL01805:Fstl4 APN 11 53186357 missense probably damaging 1.00
IGL01997:Fstl4 APN 11 53163054 nonsense probably null
IGL02386:Fstl4 APN 11 52773871 missense probably benign 0.21
IGL02536:Fstl4 APN 11 53134024 splice site probably benign
IGL02807:Fstl4 APN 11 53186674 missense probably benign 0.03
IGL03037:Fstl4 APN 11 53168223 missense possibly damaging 0.83
R0462:Fstl4 UTSW 11 53186402 missense probably benign 0.09
R1190:Fstl4 UTSW 11 53068546 missense probably benign
R1300:Fstl4 UTSW 11 53068627 missense probably benign
R1626:Fstl4 UTSW 11 53000290 nonsense probably null
R1695:Fstl4 UTSW 11 53165878 splice site probably null
R1699:Fstl4 UTSW 11 53168178 missense possibly damaging 0.81
R1727:Fstl4 UTSW 11 53068651 missense probably damaging 1.00
R1752:Fstl4 UTSW 11 53186795 missense probably benign 0.09
R1866:Fstl4 UTSW 11 53186398 missense probably benign 0.00
R4689:Fstl4 UTSW 11 53068650 nonsense probably null
R5126:Fstl4 UTSW 11 53186561 missense possibly damaging 0.71
R5129:Fstl4 UTSW 11 53186439 missense probably damaging 1.00
R5499:Fstl4 UTSW 11 53068547 missense probably benign 0.01
R5578:Fstl4 UTSW 11 53165781 missense probably damaging 1.00
R5715:Fstl4 UTSW 11 53000416 missense possibly damaging 0.53
R6125:Fstl4 UTSW 11 53186303 missense probably benign
R6177:Fstl4 UTSW 11 53168204 missense probably benign 0.00
R6236:Fstl4 UTSW 11 53186335 missense probably benign 0.00
R6611:Fstl4 UTSW 11 53186725 missense probably benign 0.01
R6886:Fstl4 UTSW 11 53186450 missense probably damaging 1.00
R7404:Fstl4 UTSW 11 53134071 missense probably benign 0.03
R7423:Fstl4 UTSW 11 53068555 missense possibly damaging 0.54
R7586:Fstl4 UTSW 11 53072429 missense probably benign 0.00
R7756:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7758:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7775:Fstl4 UTSW 11 53176971 nonsense probably null
X0013:Fstl4 UTSW 11 53162619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTTGGCTAGGGCTCAAG -3'
(R):5'- CACTGTGAATTGCCTAATGGG -3'

Sequencing Primer
(F):5'- GCTCAAGGCCAACTTCCTAACTC -3'
(R):5'- ACAGCCCAGCACTGTTTGTATAGG -3'
Posted On2018-04-02