Incidental Mutation 'R6311:Slc17a2'
ID509783
Institutional Source Beutler Lab
Gene Symbol Slc17a2
Ensembl Gene ENSMUSG00000036110
Gene Namesolute carrier family 17 (sodium phosphate), member 2
SynonymsNPT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23806993-23825180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23815022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
Predicted Effect probably benign
Transcript: ENSMUST00000006786
AA Change: T133A

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: T133A

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099697
AA Change: T133A

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: T133A

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141717
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Slc17a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc17a2 APN 13 23819334 missense probably benign 0.13
IGL01511:Slc17a2 APN 13 23819138 critical splice donor site probably null
IGL01624:Slc17a2 APN 13 23814986 missense probably benign 0.00
IGL01839:Slc17a2 APN 13 23812685 missense possibly damaging 0.91
IGL02010:Slc17a2 APN 13 23819042 missense probably benign 0.00
IGL03299:Slc17a2 APN 13 23821111 critical splice donor site probably null
R7808_slc17a2_962 UTSW 13 23819334 missense probably damaging 0.99
R0622:Slc17a2 UTSW 13 23812611 missense probably damaging 1.00
R1104:Slc17a2 UTSW 13 23819937 missense probably damaging 0.99
R1530:Slc17a2 UTSW 13 23819069 missense probably damaging 1.00
R1682:Slc17a2 UTSW 13 23812640 missense probably damaging 0.96
R2255:Slc17a2 UTSW 13 23821008 missense probably benign 0.09
R4923:Slc17a2 UTSW 13 23819095 missense probably benign 0.20
R5193:Slc17a2 UTSW 13 23819862 critical splice acceptor site probably null
R5321:Slc17a2 UTSW 13 23812631 missense possibly damaging 0.95
R5334:Slc17a2 UTSW 13 23819051 missense probably damaging 0.97
R5377:Slc17a2 UTSW 13 23812592 missense probably damaging 1.00
R6165:Slc17a2 UTSW 13 23815070 missense probably benign 0.00
R6280:Slc17a2 UTSW 13 23822394 missense probably benign
R6323:Slc17a2 UTSW 13 23814986 missense probably benign 0.00
R6476:Slc17a2 UTSW 13 23812586 missense probably damaging 1.00
R6814:Slc17a2 UTSW 13 23822389 missense possibly damaging 0.55
R7155:Slc17a2 UTSW 13 23822407 missense probably benign 0.21
R7188:Slc17a2 UTSW 13 23822365 missense probably damaging 1.00
R7288:Slc17a2 UTSW 13 23819112 missense probably benign 0.09
R7462:Slc17a2 UTSW 13 23822418 missense probably damaging 1.00
R7808:Slc17a2 UTSW 13 23819334 missense probably damaging 0.99
R7937:Slc17a2 UTSW 13 23812665 missense probably benign
R8444:Slc17a2 UTSW 13 23819078 missense probably benign 0.00
R8447:Slc17a2 UTSW 13 23822326 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTTTAGCAAAGAGGGTGCCC -3'
(R):5'- TGTGAACTGACCAGTCCAGG -3'

Sequencing Primer
(F):5'- GGGTGCCCCTACTAACTAAGAAC -3'
(R):5'- GGCCATTCCCTGCAATGAAAGTG -3'
Posted On2018-04-02