Incidental Mutation 'R6311:Adcy2'
ID509784
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Nameadenylate cyclase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68620043-68999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68625792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1044 (I1044T)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
Predicted Effect probably damaging
Transcript: ENSMUST00000022013
AA Change: I1044T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: I1044T

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0369:Adcy2 UTSW 13 68671900 missense probably benign 0.00
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0550:Adcy2 UTSW 13 68982361 missense probably benign 0.23
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R0723:Adcy2 UTSW 13 68999129 missense probably damaging 1.00
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1706:Adcy2 UTSW 13 68720746 missense probably damaging 1.00
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6917:Adcy2 UTSW 13 68620757 missense possibly damaging 0.68
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
R7919:Adcy2 UTSW 13 68887972 missense probably benign 0.08
R8144:Adcy2 UTSW 13 68734635 nonsense probably null
R8256:Adcy2 UTSW 13 68620761 missense probably damaging 1.00
R8556:Adcy2 UTSW 13 68630975 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGTCAGAGGATTTATATTTTGAAGGCC -3'
(R):5'- AGAGTTCCTGCAGTTCCAATC -3'

Sequencing Primer
(F):5'- AGGCCCATACCTTCTTATCATTAGAG -3'
(R):5'- CTTGCTAACCAAGTTCTGACATG -3'
Posted On2018-04-02