Incidental Mutation 'R6312:Olfr1055'
ID509797
Institutional Source Beutler Lab
Gene Symbol Olfr1055
Ensembl Gene ENSMUSG00000075189
Gene Nameolfactory receptor 1055
SynonymsMOR186-1, GA_x6K02T2Q125-47819205-47818258
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86346624-86350284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86347581 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 62 (F62I)
Ref Sequence ENSEMBL: ENSMUSP00000149219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
Predicted Effect probably damaging
Transcript: ENSMUST00000099894
AA Change: F62I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: F62I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188023
AA Change: F62I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: F62I

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213564
AA Change: F62I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Olfr1055
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1055 APN 2 86347733 missense possibly damaging 0.71
IGL02524:Olfr1055 APN 2 86347342 missense probably damaging 1.00
R0123:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0134:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0225:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R1981:Olfr1055 UTSW 2 86347142 missense possibly damaging 0.94
R4181:Olfr1055 UTSW 2 86347237 missense probably damaging 1.00
R5011:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5013:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5077:Olfr1055 UTSW 2 86347339 missense probably benign 0.00
R6345:Olfr1055 UTSW 2 86347548 missense probably damaging 1.00
R6591:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R6626:Olfr1055 UTSW 2 86347020 missense possibly damaging 0.81
R6680:Olfr1055 UTSW 2 86347245 missense probably damaging 1.00
R6691:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R7447:Olfr1055 UTSW 2 86346806 missense possibly damaging 0.86
R7622:Olfr1055 UTSW 2 86347662 missense possibly damaging 0.61
R8114:Olfr1055 UTSW 2 86347186 missense probably benign 0.00
R8138:Olfr1055 UTSW 2 86347586 missense possibly damaging 0.81
R8242:Olfr1055 UTSW 2 86347082 missense probably damaging 0.99
R8260:Olfr1055 UTSW 2 86346932 missense possibly damaging 0.65
Z1176:Olfr1055 UTSW 2 86346883 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGATGGCAGATGGCTACATAG -3'
(R):5'- TTCCTGAGTAGTCTAGATGGATACG -3'

Sequencing Primer
(F):5'- CTACATAGCGGTCATAGGCCATG -3'
(R):5'- TGGATACGTACAATCTTACAGTACTG -3'
Posted On2018-04-02