Incidental Mutation 'R6312:9430007A20Rik'
ID509807
Institutional Source Beutler Lab
Gene Symbol 9430007A20Rik
Ensembl Gene ENSMUSG00000028593
Gene NameRIKEN cDNA 9430007A20 gene
SynonymsLOC381572
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144519822-144529353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144528502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 164 (H164L)
Ref Sequence ENSEMBL: ENSMUSP00000030328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030328]
Predicted Effect probably benign
Transcript: ENSMUST00000030328
AA Change: H164L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030328
Gene: ENSMUSG00000028593
AA Change: H164L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 286 6.2e-32 PFAM
Pfam:Abhydrolase_3 273 381 7.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120637
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in 9430007A20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:9430007A20Rik APN 4 144528622 missense possibly damaging 0.92
IGL01866:9430007A20Rik APN 4 144528549 missense possibly damaging 0.85
IGL02736:9430007A20Rik APN 4 144528637 missense probably benign 0.15
IGL02928:9430007A20Rik APN 4 144529232 missense possibly damaging 0.93
IGL03236:9430007A20Rik APN 4 144519916 missense probably benign 0.00
R0023:9430007A20Rik UTSW 4 144528997 missense probably damaging 1.00
R0023:9430007A20Rik UTSW 4 144528997 missense probably damaging 1.00
R0304:9430007A20Rik UTSW 4 144520049 missense probably benign 0.44
R0320:9430007A20Rik UTSW 4 144522420 missense probably damaging 1.00
R0987:9430007A20Rik UTSW 4 144519932 missense possibly damaging 0.81
R1124:9430007A20Rik UTSW 4 144528624 missense probably benign 0.00
R1202:9430007A20Rik UTSW 4 144523666 missense probably benign 0.07
R1708:9430007A20Rik UTSW 4 144519941 missense probably benign 0.36
R2238:9430007A20Rik UTSW 4 144519899 missense possibly damaging 0.88
R2334:9430007A20Rik UTSW 4 144528859 missense probably damaging 1.00
R2351:9430007A20Rik UTSW 4 144528778 missense probably damaging 1.00
R4913:9430007A20Rik UTSW 4 144528811 missense possibly damaging 0.93
R5153:9430007A20Rik UTSW 4 144522267 missense probably benign 0.06
R6379:9430007A20Rik UTSW 4 144522342 missense probably benign 0.10
R7555:9430007A20Rik UTSW 4 144522354 missense probably damaging 0.99
R8077:9430007A20Rik UTSW 4 144528556 missense probably benign 0.20
Z1088:9430007A20Rik UTSW 4 144528669 missense probably damaging 1.00
Z1177:9430007A20Rik UTSW 4 144528500 nonsense probably null
Z1177:9430007A20Rik UTSW 4 144528712 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGCTTCTTCAAACTCGTG -3'
(R):5'- CAGAATTGGATAAATCAGGACCTG -3'

Sequencing Primer
(F):5'- CAGCTTCTTCAAACTCGTGTAGGG -3'
(R):5'- TTGGATAAATCAGGACCTGAGCCC -3'
Posted On2018-04-02