Mutagenetix > Incidental Mutations

Incidental Mutation 'R6312:Dpp6'

509808

Institutional Source

Beutler Lab

Gene Symbol

Dpp6

Ensembl Gene

ENSMUSG00000061576

Gene Name

dipeptidylpeptidase 6

Synonyms

Rw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R6312 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26817203-27727505 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27725671 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 834 (I834F)

Ref Sequence

ENSEMBL: ENSMUSP00000113441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071500
AA Change: I779F

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: I779F

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
Pfam:DPPIV_N	134	500	7.2e-114	PFAM
Pfam:PD40	365	402	1.1e-5	PFAM
Pfam:Peptidase_S9	579	789	2.9e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101471
AA Change: I778F

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: I778F

Domain	Start	End	E-Value	Type
transmembrane domain	34	56	N/A	INTRINSIC
Pfam:DPPIV_N	133	499	2.6e-114	PFAM
Pfam:PD40	364	401	9.3e-6	PFAM
Pfam:Peptidase_S9	578	788	1.9e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120555
AA Change: I776F

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: I776F

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
Pfam:DPPIV_N	131	497	2.6e-114	PFAM
Pfam:PD40	362	399	9.2e-6	PFAM
Pfam:Peptidase_S9	576	786	1.9e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122171
AA Change: I834F

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: I834F

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
transmembrane domain	90	112	N/A	INTRINSIC
Pfam:DPPIV_N	189	555	6.4e-113	PFAM
Pfam:PD40	425	457	1.1e-4	PFAM
Pfam:Peptidase_S9	634	844	4.3e-40	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	G	12: 72,889,767	S472P	possibly damaging	Het
9430007A20Rik	A	T	4: 144,528,502	H164L	probably benign	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
AC153874.1	T	A	10: 77,847,127		probably benign	Het
Acadvl	T	A	11: 70,011,767	M375L	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arl4d	T	C	11: 101,667,253	*202R	probably null	Het
B3gat2	G	T	1: 23,815,467	E83*	probably null	Het
BC017158	T	C	7: 128,273,543	K411R	probably benign	Het
Bmper	C	A	9: 23,406,791	Q569K	possibly damaging	Het
C2cd4d	C	A	3: 94,364,435	P336H	probably damaging	Het
Cct2	A	T	10: 117,056,055	S363T	probably benign	Het
Cers5	A	G	15: 99,747,115	V119A	probably benign	Het
Cfhr2	C	T	1: 139,831,079	V78I	possibly damaging	Het
Crocc2	A	T	1: 93,215,710	K1345*	probably null	Het
Cyp4f39	T	C	17: 32,483,294	M255T	probably benign	Het
Dpy19l4	T	A	4: 11,289,671	K205*	probably null	Het
Epg5	T	A	18: 77,979,211	D1056E	possibly damaging	Het
Fam20a	A	C	11: 109,674,630	C452G	probably damaging	Het
Gnai2	A	T	9: 107,635,117	V34E	probably damaging	Het
Gng3	A	G	19: 8,838,633	V7A	probably benign	Het
Hdc	A	G	2: 126,607,406	V77A	possibly damaging	Het
Hint1	G	A	11: 54,869,990	C85Y	probably benign	Het
Kif17	C	T	4: 138,288,193	S551L	probably benign	Het
Lgr5	A	G	10: 115,452,924	L581P	probably damaging	Het
Lig4	G	T	8: 9,971,739	N680K	probably benign	Het
Lipi	T	A	16: 75,573,915	Y138F	probably damaging	Het
Lrp2	C	T	2: 69,436,681	G4294E	probably damaging	Het
Lrrc7	A	G	3: 158,160,609	M1165T	probably benign	Het
Mtpap	T	C	18: 4,396,175	I489T	possibly damaging	Het
Nlrp1b	T	A	11: 71,228,397	N24I	probably benign	Het
Nlrp4a	A	G	7: 26,449,396	T143A	probably benign	Het
Nudt2	A	G	4: 41,480,386	T90A	probably benign	Het
Olfr1055	A	T	2: 86,347,581	F62I	probably damaging	Het
Olfr352	A	T	2: 36,870,465	I300L	probably benign	Het
Olfr659	T	A	7: 104,671,589	Y296N	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr883	TTGCTGT	TTGCTGTCTGCTGT	9: 38,026,541		probably null	Het
Olfr883	GTTT	GTTTGCTGTTTT	9: 38,026,546		probably null	Het
Olfr883	TTT	TTTGCTGATT	9: 38,026,547		probably null	Het
Olfr883	T	TGCTGTTC	9: 38,026,549		probably null	Het
Osmr	A	G	15: 6,823,638	V592A	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rsf1	A	AGGGCGACGG	7: 97,579,904		probably null	Het
Slc6a7	A	G	18: 61,002,385	S381P	probably benign	Het
Slitrk6	A	G	14: 110,750,247	L676P	probably benign	Het
Sspo	T	C	6: 48,457,366		probably null	Het
Tectb	CT	C	19: 55,192,662		probably null	Homo
Tma16	T	C	8: 66,481,466	E79G	probably damaging	Het
Trim14	G	T	4: 46,507,257	H320N	probably damaging	Het
Trim63	A	G	4: 134,325,697	D323G	probably damaging	Het
Vash2	C	A	1: 190,958,683	R309L	probably benign	Het
Vmn1r62	G	A	7: 5,676,084	V255M	possibly damaging	Het
Vmn2r53	T	A	7: 12,598,639		probably null	Het
Zfp382	G	A	7: 30,134,538	R538H	probably damaging	Het
Zfp592	T	A	7: 81,023,436	D49E	probably benign	Het
Zfp60	T	C	7: 27,748,776	C290R	probably damaging	Het
Zfp69	G	A	4: 120,949,517		probably benign	Het
Zfp790	G	T	7: 29,828,222	G111W	probably damaging	Het
Zfp948	T	C	17: 21,587,167	I207T	possibly damaging	Het

Other mutations in Dpp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Dpp6	APN	5	27723443	missense	probably damaging	1.00
IGL01137:Dpp6	APN	5	27714488	missense	probably damaging	1.00
IGL01386:Dpp6	APN	5	27664762	critical splice donor site	probably null
IGL01409:Dpp6	APN	5	27557601	missense	probably damaging	1.00
IGL01721:Dpp6	APN	5	27631520	missense	probably damaging	1.00
IGL02149:Dpp6	APN	5	27538024	missense	probably benign	0.00
IGL02174:Dpp6	APN	5	27721087	nonsense	probably null
IGL02176:Dpp6	APN	5	27723577	missense	probably damaging	0.98
IGL02326:Dpp6	APN	5	27664757	missense	probably damaging	1.00
IGL02336:Dpp6	APN	5	27469411	missense	probably benign	0.04
IGL02339:Dpp6	APN	5	27652230	missense	probably damaging	0.97
IGL02402:Dpp6	APN	5	27634543	missense	probably damaging	1.00
IGL02884:Dpp6	APN	5	27634556	missense	possibly damaging	0.88
IGL02885:Dpp6	APN	5	27718473	missense	probably damaging	1.00
IGL02938:Dpp6	APN	5	27723367	splice site	probably benign
IGL03083:Dpp6	APN	5	27709550	critical splice donor site	probably null
I0000:Dpp6	UTSW	5	27398922	missense	probably benign	0.02
IGL03052:Dpp6	UTSW	5	27709508	missense	probably benign	0.03
PIT4431001:Dpp6	UTSW	5	27631498	missense	probably benign	0.03
R0060:Dpp6	UTSW	5	27598819	missense	probably damaging	1.00
R0360:Dpp6	UTSW	5	27652269	missense	probably damaging	1.00
R0486:Dpp6	UTSW	5	27661642	missense	probably benign	0.39
R0501:Dpp6	UTSW	5	27725606	missense	probably damaging	1.00
R1028:Dpp6	UTSW	5	27666427	missense	probably benign	0.01
R1164:Dpp6	UTSW	5	27721105	missense	probably benign	0.02
R1177:Dpp6	UTSW	5	27663473	missense	possibly damaging	0.94
R1993:Dpp6	UTSW	5	27399006	missense	probably benign	0.00
R2024:Dpp6	UTSW	5	27709459	missense	possibly damaging	0.67
R2100:Dpp6	UTSW	5	27664744	missense	probably damaging	0.96
R2329:Dpp6	UTSW	5	27451288	splice site	probably null
R3619:Dpp6	UTSW	5	27721120	missense	possibly damaging	0.74
R3871:Dpp6	UTSW	5	27469465	missense	probably benign	0.03
R3872:Dpp6	UTSW	5	27721058	missense	probably damaging	1.00
R4114:Dpp6	UTSW	5	27469487	critical splice donor site	probably null
R4403:Dpp6	UTSW	5	27718462	missense	probably damaging	1.00
R4599:Dpp6	UTSW	5	27634548	missense	probably damaging	1.00
R4736:Dpp6	UTSW	5	27712659	missense	probably damaging	1.00
R4929:Dpp6	UTSW	5	27049787	missense	probably benign	0.25
R4967:Dpp6	UTSW	5	27666511	missense	probably damaging	1.00
R5162:Dpp6	UTSW	5	27399015	unclassified	probably benign
R5270:Dpp6	UTSW	5	27634534	missense	probably damaging	0.98
R5334:Dpp6	UTSW	5	27709540	missense	probably benign	0.30
R5437:Dpp6	UTSW	5	27663501	nonsense	probably null
R5663:Dpp6	UTSW	5	27049622	missense	possibly damaging	0.84
R6023:Dpp6	UTSW	5	27723547	missense	probably damaging	0.96
R6244:Dpp6	UTSW	5	27049628	missense	probably damaging	0.99
R6442:Dpp6	UTSW	5	27718509	critical splice donor site	probably null
R6942:Dpp6	UTSW	5	27469459	missense	possibly damaging	0.79
R6956:Dpp6	UTSW	5	27598821	missense	probably damaging	1.00
R7210:Dpp6	UTSW	5	27598803	missense	probably damaging	0.99
R7342:Dpp6	UTSW	5	27714554	missense	probably benign
R7702:Dpp6	UTSW	5	27652276	missense	probably benign	0.00
R7727:Dpp6	UTSW	5	27451244	missense	probably benign	0.30
R7899:Dpp6	UTSW	5	27721079	missense	probably benign	0.03
R7966:Dpp6	UTSW	5	27723372	missense	probably benign	0.06
R8015:Dpp6	UTSW	5	26817810	start gained	probably benign
R8084:Dpp6	UTSW	5	27631399	missense	probably benign	0.32
R8178:Dpp6	UTSW	5	27598817	missense	probably damaging	1.00
R8384:Dpp6	UTSW	5	27718474	missense	probably benign	0.18
R8816:Dpp6	UTSW	5	27725713	missense	probably benign	0.07
Z1176:Dpp6	UTSW	5	27398998	missense	probably damaging	1.00
Z1177:Dpp6	UTSW	5	27712642	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCAGAGGCAAACTGTACAC -3'
(R):5'- CCACCAAATGGCCTTCAATATGG -3'

Sequencing Primer
(F):5'- GAGGCAAACTGTACACAACACTG -3'
(R):5'- ACATGCTATGGAATGCCCG -3'

Posted On

2018-04-02