Incidental Mutation 'R6312:Vmn2r53'
ID 509811
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 044415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6312 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 12332566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412] [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118665
Predicted Effect probably null
Transcript: ENSMUST00000170412
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170412
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,936,541 (GRCm39) S472P possibly damaging Het
Aadacl4fm1 A T 4: 144,255,072 (GRCm39) H164L probably benign Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
AC153874.1 T A 10: 77,682,961 (GRCm39) probably benign Het
Acadvl T A 11: 69,902,593 (GRCm39) M375L probably damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arl4d T C 11: 101,558,079 (GRCm39) *202R probably null Het
B3gat2 G T 1: 23,854,548 (GRCm39) E83* probably null Het
Bmper C A 9: 23,318,087 (GRCm39) Q569K possibly damaging Het
C2cd4d C A 3: 94,271,742 (GRCm39) P336H probably damaging Het
Cct2 A T 10: 116,891,960 (GRCm39) S363T probably benign Het
Cers5 A G 15: 99,644,996 (GRCm39) V119A probably benign Het
Cfhr2 C T 1: 139,758,817 (GRCm39) V78I possibly damaging Het
Crocc2 A T 1: 93,143,432 (GRCm39) K1345* probably null Het
Cyp4f39 T C 17: 32,702,268 (GRCm39) M255T probably benign Het
Dpp6 A T 5: 27,930,669 (GRCm39) I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 (GRCm39) K205* probably null Het
Epg5 T A 18: 78,022,426 (GRCm39) D1056E possibly damaging Het
Fam20a A C 11: 109,565,456 (GRCm39) C452G probably damaging Het
Gnai2 A T 9: 107,512,316 (GRCm39) V34E probably damaging Het
Gng3 A G 19: 8,815,997 (GRCm39) V7A probably benign Het
Hdc A G 2: 126,449,326 (GRCm39) V77A possibly damaging Het
Hint1 G A 11: 54,760,816 (GRCm39) C85Y probably benign Het
Kif17 C T 4: 138,015,504 (GRCm39) S551L probably benign Het
Lgr5 A G 10: 115,288,829 (GRCm39) L581P probably damaging Het
Lig4 G T 8: 10,021,739 (GRCm39) N680K probably benign Het
Lipi T A 16: 75,370,803 (GRCm39) Y138F probably damaging Het
Lrp2 C T 2: 69,267,025 (GRCm39) G4294E probably damaging Het
Lrrc7 A G 3: 157,866,246 (GRCm39) M1165T probably benign Het
Mtpap T C 18: 4,396,175 (GRCm39) I489T possibly damaging Het
Nlrp1b T A 11: 71,119,223 (GRCm39) N24I probably benign Het
Nlrp4a A G 7: 26,148,821 (GRCm39) T143A probably benign Het
Nudt2 A G 4: 41,480,386 (GRCm39) T90A probably benign Het
Or1j20 A T 2: 36,760,477 (GRCm39) I300L probably benign Het
Or52n20 T A 7: 104,320,796 (GRCm39) Y296N probably damaging Het
Or8b36 GTTT GTTTGCTGTTTT 9: 37,937,842 (GRCm39) probably null Het
Or8b36 TTT TTTGCTGATT 9: 37,937,843 (GRCm39) probably null Het
Or8b36 T TGCTGTTC 9: 37,937,845 (GRCm39) probably null Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8b36 TTGCTGT TTGCTGTCTGCTGT 9: 37,937,837 (GRCm39) probably null Het
Or8k53 A T 2: 86,177,925 (GRCm39) F62I probably damaging Het
Osmr A G 15: 6,853,119 (GRCm39) V592A probably damaging Het
Rbp2 G T 9: 98,372,700 (GRCm39) S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Rusf1 T C 7: 127,872,715 (GRCm39) K411R probably benign Het
Slc6a7 A G 18: 61,135,457 (GRCm39) S381P probably benign Het
Slitrk6 A G 14: 110,987,679 (GRCm39) L676P probably benign Het
Sspo T C 6: 48,434,300 (GRCm39) probably null Het
Tectb CT C 19: 55,181,094 (GRCm39) probably null Homo
Tma16 T C 8: 66,934,118 (GRCm39) E79G probably damaging Het
Trim14 G T 4: 46,507,257 (GRCm39) H320N probably damaging Het
Trim63 A G 4: 134,053,008 (GRCm39) D323G probably damaging Het
Vash2 C A 1: 190,690,880 (GRCm39) R309L probably benign Het
Vmn1r62 G A 7: 5,679,083 (GRCm39) V255M possibly damaging Het
Zfp382 G A 7: 29,833,963 (GRCm39) R538H probably damaging Het
Zfp592 T A 7: 80,673,184 (GRCm39) D49E probably benign Het
Zfp60 T C 7: 27,448,201 (GRCm39) C290R probably damaging Het
Zfp69 G A 4: 120,806,714 (GRCm39) probably benign Het
Zfp790 G T 7: 29,527,647 (GRCm39) G111W probably damaging Het
Zfp948 T C 17: 21,807,429 (GRCm39) I207T possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1102:Vmn2r53 UTSW 7 12,332,410 (GRCm39) missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12,335,366 (GRCm39) missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12,315,513 (GRCm39) nonsense probably null
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12,340,418 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGGCTTGAGGGTCTATC -3'
(R):5'- CCTTGGAGCAAGCATCACATTG -3'

Sequencing Primer
(F):5'- TGAGGGTCTATCAAGCCTACATGC -3'
(R):5'- AACATTGCCAAGGGTGTCTC -3'
Posted On 2018-04-02