Incidental Mutation 'R6312:Zfp790'
ID 509814
Institutional Source Beutler Lab
Gene Symbol Zfp790
Ensembl Gene ENSMUSG00000011427
Gene Name zinc finger protein 790
Synonyms 6330581L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6312 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 29816114-29831005 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29828222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 111 (G111W)
Ref Sequence ENSEMBL: ENSMUSP00000136932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032796] [ENSMUST00000178162]
AlphaFold Q80ZX2
Predicted Effect probably damaging
Transcript: ENSMUST00000032796
AA Change: G111W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032796
Gene: ENSMUSG00000011427
AA Change: G111W

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
Pfam:zf-C2H2_6 391 403 2.4e-1 PFAM
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178162
AA Change: G111W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136932
Gene: ENSMUSG00000011427
AA Change: G111W

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Zfp790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp790 APN 7 29828563 missense probably benign 0.32
IGL00979:Zfp790 APN 7 29829609 missense probably benign 0.00
IGL02286:Zfp790 APN 7 29829735 missense possibly damaging 0.53
IGL03136:Zfp790 APN 7 29829895 nonsense probably null
R0021:Zfp790 UTSW 7 29825688 unclassified probably benign
R0077:Zfp790 UTSW 7 29824875 missense probably damaging 0.98
R1477:Zfp790 UTSW 7 29823100 start gained probably benign
R1572:Zfp790 UTSW 7 29828139 missense probably benign 0.33
R2015:Zfp790 UTSW 7 29828861 missense probably benign 0.29
R4941:Zfp790 UTSW 7 29829491 missense possibly damaging 0.83
R5019:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5159:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5160:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5722:Zfp790 UTSW 7 29830089 nonsense probably null
R5954:Zfp790 UTSW 7 29829504 missense probably damaging 1.00
R6025:Zfp790 UTSW 7 29829545 missense possibly damaging 0.71
R7392:Zfp790 UTSW 7 29828625 missense possibly damaging 0.52
R7623:Zfp790 UTSW 7 29825705 nonsense probably null
R8036:Zfp790 UTSW 7 29828921 missense possibly damaging 0.92
R8175:Zfp790 UTSW 7 29829780 missense possibly damaging 0.96
R8898:Zfp790 UTSW 7 29823100 start gained probably benign
R8988:Zfp790 UTSW 7 29828168 missense probably benign
R9176:Zfp790 UTSW 7 29829962 missense probably benign 0.04
R9404:Zfp790 UTSW 7 29825760 missense probably benign
R9519:Zfp790 UTSW 7 29823142 missense unknown
Z1186:Zfp790 UTSW 7 29829684 missense possibly damaging 0.53
Z1186:Zfp790 UTSW 7 29829783 missense possibly damaging 0.72
Z1186:Zfp790 UTSW 7 29829833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCATGAGCTTCACTTTAACCG -3'
(R):5'- GGGCTCTGGTGCAAAACTAAAG -3'

Sequencing Primer
(F):5'- ACTTTAACCGTAGCTTTTGGTAGC -3'
(R):5'- GGTGCAAAACTAAAGGATTTTTCCG -3'
Posted On 2018-04-02