Incidental Mutation 'R6312:Zfp790'
ID509814
Institutional Source Beutler Lab
Gene Symbol Zfp790
Ensembl Gene ENSMUSG00000011427
Gene Namezinc finger protein 790
Synonyms6330581L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29816114-29831005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29828222 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 111 (G111W)
Ref Sequence ENSEMBL: ENSMUSP00000136932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032796] [ENSMUST00000178162]
Predicted Effect probably damaging
Transcript: ENSMUST00000032796
AA Change: G111W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032796
Gene: ENSMUSG00000011427
AA Change: G111W

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
Pfam:zf-C2H2_6 391 403 2.4e-1 PFAM
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178162
AA Change: G111W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136932
Gene: ENSMUSG00000011427
AA Change: G111W

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Zfp790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp790 APN 7 29828563 missense probably benign 0.32
IGL00979:Zfp790 APN 7 29829609 missense probably benign 0.00
IGL02286:Zfp790 APN 7 29829735 missense possibly damaging 0.53
IGL03136:Zfp790 APN 7 29829895 nonsense probably null
R0021:Zfp790 UTSW 7 29825688 unclassified probably benign
R0077:Zfp790 UTSW 7 29824875 missense probably damaging 0.98
R1477:Zfp790 UTSW 7 29823100 start gained probably benign
R1572:Zfp790 UTSW 7 29828139 missense probably benign 0.33
R2015:Zfp790 UTSW 7 29828861 missense probably benign 0.29
R4941:Zfp790 UTSW 7 29829491 missense possibly damaging 0.83
R5019:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5159:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5160:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5722:Zfp790 UTSW 7 29830089 nonsense probably null
R5954:Zfp790 UTSW 7 29829504 missense probably damaging 1.00
R6025:Zfp790 UTSW 7 29829545 missense possibly damaging 0.71
R7392:Zfp790 UTSW 7 29828625 missense possibly damaging 0.52
R7623:Zfp790 UTSW 7 29825705 nonsense probably null
R8036:Zfp790 UTSW 7 29828921 missense possibly damaging 0.92
R8175:Zfp790 UTSW 7 29829780 missense possibly damaging 0.96
Z1186:Zfp790 UTSW 7 29829684 missense possibly damaging 0.53
Z1186:Zfp790 UTSW 7 29829783 missense possibly damaging 0.72
Z1186:Zfp790 UTSW 7 29829833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCATGAGCTTCACTTTAACCG -3'
(R):5'- GGGCTCTGGTGCAAAACTAAAG -3'

Sequencing Primer
(F):5'- ACTTTAACCGTAGCTTTTGGTAGC -3'
(R):5'- GGTGCAAAACTAAAGGATTTTTCCG -3'
Posted On2018-04-02