Incidental Mutation 'R6312:Zfp592'
ID509816
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81023436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 49 (D49E)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect probably benign
Transcript: ENSMUST00000107353
AA Change: D49E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: D49E

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
R8440:Zfp592 UTSW 7 81041523 missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 81023573 missense probably damaging 1.00
R8766:Zfp592 UTSW 7 81024605 missense probably benign 0.00
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTTGTCAGCATCCAGC -3'
(R):5'- GCTCTAGCTTGCTTGTGAAAC -3'

Sequencing Primer
(F):5'- CCATGGGGGATATGAAAACTCC -3'
(R):5'- GTAGAATCAAACTTCCCACAGTGGTG -3'
Posted On2018-04-02