Incidental Mutation 'R6312:Lig4'
ID509821
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Nameligase IV, DNA, ATP-dependent
SynonymsDNA ligase IV, 5830471N16Rik, tiny
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location9969049-9977686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9971739 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 680 (N680K)
Ref Sequence ENSEMBL: ENSMUSP00000130807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095476] [ENSMUST00000170033]
Predicted Effect probably benign
Transcript: ENSMUST00000095476
AA Change: N680K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: N680K

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170033
AA Change: N680K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: N680K

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
nosegay UTSW 8 9972954 missense probably damaging 1.00
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB004:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8113:Lig4 UTSW 8 9973485 missense probably benign 0.07
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
R8443:Lig4 UTSW 8 9973777 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- ATAAAGCGAGGTTGCCACGG -3'
(R):5'- TTGCCACGAAACACCTTCATG -3'

Sequencing Primer
(F):5'- GGCACGCATGTTTTTGTCTTAAAAC -3'
(R):5'- CCTTCATGTAGGTGATGATGATGAAC -3'
Posted On2018-04-02