Incidental Mutation 'R6312:Rbp2'
ID509830
Institutional Source Beutler Lab
Gene Symbol Rbp2
Ensembl Gene ENSMUSG00000032454
Gene Nameretinol binding protein 2, cellular
SynonymsRbp-2, CrbpII, Crbp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location98486115-98509781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98490647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 13 (S13I)
Ref Sequence ENSEMBL: ENSMUSP00000140676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035029] [ENSMUST00000187905] [ENSMUST00000189446]
Predicted Effect probably benign
Transcript: ENSMUST00000035029
AA Change: S13I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035029
Gene: ENSMUSG00000032454
AA Change: S13I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187905
AA Change: S13I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140630
Gene: ENSMUSG00000032454
AA Change: S13I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188779
Predicted Effect probably benign
Transcript: ENSMUST00000189446
AA Change: S13I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140676
Gene: ENSMUSG00000032454
AA Change: S13I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195675
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant protein present in the small intestinal epithelium. It is thought to participate in the uptake and/or intracellular metabolism of vitamin A. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. This protein may also modulate the supply of retinoic acid to the nuclei of endometrial cells during the menstrual cycle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Saturable vitamin A (retinol) uptake is impaired in homozygous mutant mice. Serum retinol levels are unaffected when with normal dietary intake, however, pups of homozygous dams fed a marginal retinol diet show increased neonatal lethality due to inadequate retinal transport to the fetus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Rbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Rbp2 APN 9 98498897 splice site probably null
R3780:Rbp2 UTSW 9 98498826 missense probably benign
R4835:Rbp2 UTSW 9 98507823 missense probably damaging 0.99
R4980:Rbp2 UTSW 9 98498841 missense probably benign 0.01
R6253:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6254:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6394:Rbp2 UTSW 9 98507820 missense possibly damaging 0.91
R6819:Rbp2 UTSW 9 98509561 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAGACCTGTTGAACTTTGC -3'
(R):5'- GGACTTAACTGACTCTGCCCTG -3'

Sequencing Primer
(F):5'- GACCTGTTGAACTTTGCAAAGGC -3'
(R):5'- TGCCCTGCTACAACTCTGGAG -3'
Posted On2018-04-02