Mutagenetix > Incidental Mutations

Incidental Mutation 'R6312:Gnai2'

509831

Institutional Source

Beutler Lab

Gene Symbol

Gnai2

Ensembl Gene

ENSMUSG00000032562

Gene Name

guanine nucleotide binding protein (G protein), alpha inhibiting 2

Synonyms

Gia, Galphai2, Gnai-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.870) question?

Stock #

R6312 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

107614125-107635367 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107635117 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 34 (V34E)

Ref Sequence

ENSEMBL: ENSMUSP00000142060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055704] [ENSMUST00000192615] [ENSMUST00000192837] [ENSMUST00000193876]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055704
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057543
Gene: ENSMUSG00000032562
AA Change: V34E

Domain	Start	End	E-Value	Type
G_alpha	13	354	2.1e-219	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192615
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142326
Gene: ENSMUSG00000032562
AA Change: V34E

Domain	Start	End	E-Value	Type
G_alpha	13	354	2.1e-219	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192837
AA Change: V34E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141929
Gene: ENSMUSG00000032562
AA Change: V34E

Domain	Start	End	E-Value	Type
PDB:4N0E\|A	1	40	4e-18	PDB
Blast:G_alpha	13	85	9e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193835

Predicted Effect

probably damaging
Transcript: ENSMUST00000193876
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195284

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Nullizygous mice exhibit growth retardation, lethal ulcerative colitis, colon adenocarcinomas, granulocytosis, altered thymocyte maturation and function and enhanced production of pro-inflammatory cytokines, and may show alterations in leukocyte physiology and susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	G	12: 72,889,767	S472P	possibly damaging	Het
9430007A20Rik	A	T	4: 144,528,502	H164L	probably benign	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
AC153874.1	T	A	10: 77,847,127		probably benign	Het
Acadvl	T	A	11: 70,011,767	M375L	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arl4d	T	C	11: 101,667,253	*202R	probably null	Het
B3gat2	G	T	1: 23,815,467	E83*	probably null	Het
BC017158	T	C	7: 128,273,543	K411R	probably benign	Het
Bmper	C	A	9: 23,406,791	Q569K	possibly damaging	Het
C2cd4d	C	A	3: 94,364,435	P336H	probably damaging	Het
Cct2	A	T	10: 117,056,055	S363T	probably benign	Het
Cers5	A	G	15: 99,747,115	V119A	probably benign	Het
Cfhr2	C	T	1: 139,831,079	V78I	possibly damaging	Het
Crocc2	A	T	1: 93,215,710	K1345*	probably null	Het
Cyp4f39	T	C	17: 32,483,294	M255T	probably benign	Het
Dpp6	A	T	5: 27,725,671	I834F	possibly damaging	Het
Dpy19l4	T	A	4: 11,289,671	K205*	probably null	Het
Epg5	T	A	18: 77,979,211	D1056E	possibly damaging	Het
Fam20a	A	C	11: 109,674,630	C452G	probably damaging	Het
Gng3	A	G	19: 8,838,633	V7A	probably benign	Het
Hdc	A	G	2: 126,607,406	V77A	possibly damaging	Het
Hint1	G	A	11: 54,869,990	C85Y	probably benign	Het
Kif17	C	T	4: 138,288,193	S551L	probably benign	Het
Lgr5	A	G	10: 115,452,924	L581P	probably damaging	Het
Lig4	G	T	8: 9,971,739	N680K	probably benign	Het
Lipi	T	A	16: 75,573,915	Y138F	probably damaging	Het
Lrp2	C	T	2: 69,436,681	G4294E	probably damaging	Het
Lrrc7	A	G	3: 158,160,609	M1165T	probably benign	Het
Mtpap	T	C	18: 4,396,175	I489T	possibly damaging	Het
Nlrp1b	T	A	11: 71,228,397	N24I	probably benign	Het
Nlrp4a	A	G	7: 26,449,396	T143A	probably benign	Het
Nudt2	A	G	4: 41,480,386	T90A	probably benign	Het
Olfr1055	A	T	2: 86,347,581	F62I	probably damaging	Het
Olfr352	A	T	2: 36,870,465	I300L	probably benign	Het
Olfr659	T	A	7: 104,671,589	Y296N	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr883	TTGCTGT	TTGCTGTCTGCTGT	9: 38,026,541		probably null	Het
Olfr883	GTTT	GTTTGCTGTTTT	9: 38,026,546		probably null	Het
Olfr883	TTT	TTTGCTGATT	9: 38,026,547		probably null	Het
Olfr883	T	TGCTGTTC	9: 38,026,549		probably null	Het
Osmr	A	G	15: 6,823,638	V592A	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rsf1	A	AGGGCGACGG	7: 97,579,904		probably null	Het
Slc6a7	A	G	18: 61,002,385	S381P	probably benign	Het
Slitrk6	A	G	14: 110,750,247	L676P	probably benign	Het
Sspo	T	C	6: 48,457,366		probably null	Het
Tectb	CT	C	19: 55,192,662		probably null	Homo
Tma16	T	C	8: 66,481,466	E79G	probably damaging	Het
Trim14	G	T	4: 46,507,257	H320N	probably damaging	Het
Trim63	A	G	4: 134,325,697	D323G	probably damaging	Het
Vash2	C	A	1: 190,958,683	R309L	probably benign	Het
Vmn1r62	G	A	7: 5,676,084	V255M	possibly damaging	Het
Vmn2r53	T	A	7: 12,598,639		probably null	Het
Zfp382	G	A	7: 30,134,538	R538H	probably damaging	Het
Zfp592	T	A	7: 81,023,436	D49E	probably benign	Het
Zfp60	T	C	7: 27,748,776	C290R	probably damaging	Het
Zfp69	G	A	4: 120,949,517		probably benign	Het
Zfp790	G	T	7: 29,828,222	G111W	probably damaging	Het
Zfp948	T	C	17: 21,587,167	I207T	possibly damaging	Het

Other mutations in Gnai2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01760:Gnai2	APN	9	107616518	missense	probably damaging	1.00
IGL02408:Gnai2	APN	9	107616194	missense	probably benign
R0520:Gnai2	UTSW	9	107620173	missense	probably benign	0.01
R1106:Gnai2	UTSW	9	107620186	missense	probably damaging	1.00
R5443:Gnai2	UTSW	9	107620187	missense	probably damaging	0.96
R5479:Gnai2	UTSW	9	107635166	missense	probably benign	0.14
R6313:Gnai2	UTSW	9	107620097	missense	possibly damaging	0.49
R7240:Gnai2	UTSW	9	107615773	missense
R7748:Gnai2	UTSW	9	107615735	missense
R8696:Gnai2	UTSW	9	107619769	missense

Predicted Primers

PCR Primer
(F):5'- AGACCAATCCAGAGTTTCGG -3'
(R):5'- GAGCCTAACTTCTCCCTTGG -3'

Sequencing Primer
(F):5'- CGGATCTTAAAAGGGTGGCTCCTAC -3'
(R):5'- AACTGCGGACCTGAGAGCTTC -3'

Posted On

2018-04-02