Incidental Mutation 'R6312:Gnai2'
ID 509831
Institutional Source Beutler Lab
Gene Symbol Gnai2
Ensembl Gene ENSMUSG00000032562
Gene Name guanine nucleotide binding protein (G protein), alpha inhibiting 2
Synonyms Gia, Galphai2, Gnai-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock # R6312 (G1)
Quality Score 224.009
Status Not validated
Chromosome 9
Chromosomal Location 107614125-107635367 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107635117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000142060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055704] [ENSMUST00000192615] [ENSMUST00000192837] [ENSMUST00000193876]
AlphaFold P08752
Predicted Effect probably damaging
Transcript: ENSMUST00000055704
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057543
Gene: ENSMUSG00000032562
AA Change: V34E

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192615
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142326
Gene: ENSMUSG00000032562
AA Change: V34E

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192837
AA Change: V34E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141929
Gene: ENSMUSG00000032562
AA Change: V34E

DomainStartEndE-ValueType
PDB:4N0E|A 1 40 4e-18 PDB
Blast:G_alpha 13 85 9e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193835
Predicted Effect probably damaging
Transcript: ENSMUST00000193876
AA Change: V34E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195284
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Nullizygous mice exhibit growth retardation, lethal ulcerative colitis, colon adenocarcinomas, granulocytosis, altered thymocyte maturation and function and enhanced production of pro-inflammatory cytokines, and may show alterations in leukocyte physiology and susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Gnai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Gnai2 APN 9 107616518 missense probably damaging 1.00
IGL02408:Gnai2 APN 9 107616194 missense probably benign
R0520:Gnai2 UTSW 9 107620173 missense probably benign 0.01
R1106:Gnai2 UTSW 9 107620186 missense probably damaging 1.00
R5443:Gnai2 UTSW 9 107620187 missense probably damaging 0.96
R5479:Gnai2 UTSW 9 107635166 missense probably benign 0.14
R6313:Gnai2 UTSW 9 107620097 missense possibly damaging 0.49
R7240:Gnai2 UTSW 9 107615773 missense
R7748:Gnai2 UTSW 9 107615735 missense
R8696:Gnai2 UTSW 9 107619769 missense
R8862:Gnai2 UTSW 9 107635127 missense
R9320:Gnai2 UTSW 9 107615714 missense
Predicted Primers PCR Primer
(F):5'- AGACCAATCCAGAGTTTCGG -3'
(R):5'- GAGCCTAACTTCTCCCTTGG -3'

Sequencing Primer
(F):5'- CGGATCTTAAAAGGGTGGCTCCTAC -3'
(R):5'- AACTGCGGACCTGAGAGCTTC -3'
Posted On 2018-04-02