Incidental Mutation 'R6312:Cct2'
ID509834
Institutional Source Beutler Lab
Gene Symbol Cct2
Ensembl Gene ENSMUSG00000034024
Gene Namechaperonin containing Tcp1, subunit 2 (beta)
SynonymsCctb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117051001-117063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117056055 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 363 (S363T)
Ref Sequence ENSEMBL: ENSMUSP00000036288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047672] [ENSMUST00000219036] [ENSMUST00000219573]
Predicted Effect probably benign
Transcript: ENSMUST00000047672
AA Change: S363T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000036288
Gene: ENSMUSG00000034024
AA Change: S363T

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 35 525 3.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218502
Predicted Effect probably benign
Transcript: ENSMUST00000219036
Predicted Effect probably benign
Transcript: ENSMUST00000219573
Predicted Effect probably benign
Transcript: ENSMUST00000219690
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Cct2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Cct2 APN 10 117053112 missense probably damaging 0.99
IGL02150:Cct2 APN 10 117062099 missense probably damaging 0.99
IGL02349:Cct2 APN 10 117053139 missense probably benign 0.04
IGL03010:Cct2 APN 10 117058114 missense probably damaging 1.00
IGL03155:Cct2 APN 10 117060671 missense probably damaging 0.99
R0507:Cct2 UTSW 10 117055246 splice site probably null
R0742:Cct2 UTSW 10 117055246 splice site probably null
R1102:Cct2 UTSW 10 117060640 splice site probably null
R1438:Cct2 UTSW 10 117054992 unclassified probably benign
R2040:Cct2 UTSW 10 117053113 missense probably benign 0.00
R2157:Cct2 UTSW 10 117062809 splice site probably benign
R2227:Cct2 UTSW 10 117053017 missense probably null 0.18
R3410:Cct2 UTSW 10 117062063 missense probably benign 0.01
R3981:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R3983:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R4364:Cct2 UTSW 10 117055151 missense probably damaging 1.00
R4401:Cct2 UTSW 10 117057809 missense possibly damaging 0.61
R6162:Cct2 UTSW 10 117058186 missense probably damaging 0.99
R6300:Cct2 UTSW 10 117056159 missense probably damaging 0.96
R7075:Cct2 UTSW 10 117061465 missense unknown
R7198:Cct2 UTSW 10 117053124 missense probably benign
R7236:Cct2 UTSW 10 117061559 missense probably benign 0.00
R8373:Cct2 UTSW 10 117060824 missense possibly damaging 0.95
R8803:Cct2 UTSW 10 117058185 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCCTCATAAGACACATATATCCAG -3'
(R):5'- GGGTCAAGTATGTACCTTGTGC -3'

Sequencing Primer
(F):5'- TAGTATGAGTACACTGCCGCTGAC -3'
(R):5'- GTACCTTGTGCTTGATTTGACATATC -3'
Posted On2018-04-02