Incidental Mutation 'R6312:4930447C04Rik'
ID509840
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene NameRIKEN cDNA 4930447C04 gene
SynonymsSix6as, Six6os1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72881109-72940774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72889767 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 472 (S472P)
Ref Sequence ENSEMBL: ENSMUSP00000106115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044000
AA Change: S471P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098
AA Change: S471P

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110489
AA Change: S472P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098
AA Change: S472P

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132901
Predicted Effect probably benign
Transcript: ENSMUST00000143960
SMART Domains Protein: ENSMUSP00000116391
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 1 70 6.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1271:4930447C04Rik UTSW 12 72892883 missense possibly damaging 0.71
R1321:4930447C04Rik UTSW 12 72898544 splice site probably benign
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1424:4930447C04Rik UTSW 12 72892895 nonsense probably null
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R5243:4930447C04Rik UTSW 12 72909769 critical splice donor site probably null
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
R7275:4930447C04Rik UTSW 12 72910021 missense possibly damaging 0.71
R8427:4930447C04Rik UTSW 12 72903286 missense possibly damaging 0.86
R8669:4930447C04Rik UTSW 12 72902460 missense probably benign 0.32
R8674:4930447C04Rik UTSW 12 72909922 missense probably benign 0.00
RF041:4930447C04Rik UTSW 12 72881276 small deletion probably benign
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Z1176:4930447C04Rik UTSW 12 72916726 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GACGGTCATAGGGAACTCTG -3'
(R):5'- ACCGGTACACCATTGCTTTTG -3'

Sequencing Primer
(F):5'- TGCCTCAAGGACACTAGTCGAG -3'
(R):5'- GGTGCTTCCCAGTCTGCATTG -3'
Posted On2018-04-02