Incidental Mutation 'R6312:Cers5'
ID509843
Institutional Source Beutler Lab
Gene Symbol Cers5
Ensembl Gene ENSMUSG00000023021
Gene Nameceramide synthase 5
SynonymsCerS5, Trh4, 2310081H14Rik, Lass5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99734881-99772885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99747115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000135074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023762] [ENSMUST00000109035] [ENSMUST00000175876] [ENSMUST00000176248] [ENSMUST00000176627]
Predicted Effect probably benign
Transcript: ENSMUST00000023762
AA Change: V119A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023762
Gene: ENSMUSG00000023021
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
low complexity region 343 361 N/A INTRINSIC
low complexity region 366 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109035
AA Change: V119A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104663
Gene: ENSMUSG00000023021
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 6e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175876
AA Change: V70A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134845
Gene: ENSMUSG00000023021
AA Change: V70A

DomainStartEndE-ValueType
HOX 29 91 5.6e-2 SMART
TLC 90 241 1.29e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176248
AA Change: V119A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135074
Gene: ENSMUSG00000023021
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-18 BLAST
HOX 78 140 2.8e-4 SMART
TLC 139 251 1.7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176627
AA Change: V68A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134988
Gene: ENSMUSG00000023021
AA Change: V68A

DomainStartEndE-ValueType
HOX 27 89 5.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176970
SMART Domains Protein: ENSMUSP00000135723
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
TLC 1 153 3.49e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TLC (TRAM, LAG1 and CLN8 homology domains) family of proteins. The encoded protein functions in the synthesis of ceramide, a lipid molecule that is involved in a several cellular signaling pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Cers5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Cers5 APN 15 99739655 nonsense probably null
coleman UTSW 15 99751238 nonsense probably null
R0178:Cers5 UTSW 15 99747024 splice site probably benign
R0483:Cers5 UTSW 15 99745914 missense probably damaging 1.00
R0589:Cers5 UTSW 15 99740956 missense probably damaging 1.00
R1433:Cers5 UTSW 15 99745931 nonsense probably null
R1757:Cers5 UTSW 15 99736331 missense probably benign 0.31
R2520:Cers5 UTSW 15 99736381 missense probably damaging 0.97
R3008:Cers5 UTSW 15 99772717 unclassified probably benign
R3010:Cers5 UTSW 15 99772717 unclassified probably benign
R3011:Cers5 UTSW 15 99772717 unclassified probably benign
R4379:Cers5 UTSW 15 99751253 missense probably damaging 1.00
R4732:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4733:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4911:Cers5 UTSW 15 99747079 missense probably damaging 1.00
R5441:Cers5 UTSW 15 99751238 nonsense probably null
R6089:Cers5 UTSW 15 99741002 missense probably benign 0.01
R6161:Cers5 UTSW 15 99738663 critical splice donor site probably null
R6247:Cers5 UTSW 15 99745924 missense probably benign 0.03
R6300:Cers5 UTSW 15 99772219 missense probably damaging 1.00
R6861:Cers5 UTSW 15 99772363 unclassified probably benign
R7780:Cers5 UTSW 15 99739708 missense probably damaging 1.00
R7800:Cers5 UTSW 15 99736241 missense probably benign 0.02
R7843:Cers5 UTSW 15 99772331 missense unknown
R7995:Cers5 UTSW 15 99740942 critical splice donor site probably null
R8491:Cers5 UTSW 15 99740950 missense probably damaging 1.00
R8789:Cers5 UTSW 15 99739670 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGACATTCATCGTCCCAACAG -3'
(R):5'- CTTCCTTAAACCAACTGTGTGATG -3'

Sequencing Primer
(F):5'- ATCGTCCCAACAGTAAACTTATTTCC -3'
(R):5'- TAAAACATGGAGAAGCTGTGTAGTAG -3'
Posted On2018-04-02