Incidental Mutation 'R6312:Cyp4f39'
ID509846
Institutional Source Beutler Lab
Gene Symbol Cyp4f39
Ensembl Gene ENSMUSG00000061126
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms4732474A20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177307; MGI: 2445210

Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32468462-32492479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32483294 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 255 (M255T)
Ref Sequence ENSEMBL: ENSMUSP00000003413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003413]
Predicted Effect probably benign
Transcript: ENSMUST00000003413
AA Change: M255T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003413
Gene: ENSMUSG00000061126
AA Change: M255T

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
Pfam:p450 60 525 5.8e-124 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Cyp4f39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cyp4f39 APN 17 32470912 missense probably damaging 1.00
IGL00822:Cyp4f39 APN 17 32470832 missense probably benign 0.03
IGL00857:Cyp4f39 APN 17 32489657 missense probably benign 0.08
IGL01380:Cyp4f39 APN 17 32481858 missense probably damaging 1.00
IGL01532:Cyp4f39 APN 17 32470954 splice site probably benign
IGL01756:Cyp4f39 APN 17 32483441 nonsense probably null
IGL02090:Cyp4f39 APN 17 32470958 splice site probably benign
IGL02477:Cyp4f39 APN 17 32489645 missense probably benign 0.40
IGL02824:Cyp4f39 APN 17 32468685 critical splice donor site probably null
N/A:Cyp4f39 UTSW 17 32468681 missense probably benign 0.03
R0145:Cyp4f39 UTSW 17 32486960 missense possibly damaging 0.92
R0288:Cyp4f39 UTSW 17 32492436 missense probably benign 0.01
R1676:Cyp4f39 UTSW 17 32482202 missense probably benign 0.41
R1677:Cyp4f39 UTSW 17 32492330 missense probably benign 0.30
R1874:Cyp4f39 UTSW 17 32483324 missense probably damaging 1.00
R1920:Cyp4f39 UTSW 17 32483291 missense probably benign 0.00
R2049:Cyp4f39 UTSW 17 32482138 missense probably benign 0.41
R2139:Cyp4f39 UTSW 17 32491189 missense probably benign 0.01
R2212:Cyp4f39 UTSW 17 32487063 missense possibly damaging 0.62
R3416:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R3417:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R4486:Cyp4f39 UTSW 17 32483454 missense probably damaging 1.00
R5023:Cyp4f39 UTSW 17 32481104 missense probably damaging 1.00
R5523:Cyp4f39 UTSW 17 32470833 missense probably benign 0.10
R5714:Cyp4f39 UTSW 17 32481825 missense probably damaging 1.00
R6010:Cyp4f39 UTSW 17 32482186 missense probably damaging 0.99
R6477:Cyp4f39 UTSW 17 32481817 missense probably damaging 0.99
R6950:Cyp4f39 UTSW 17 32492306 missense probably damaging 1.00
R7228:Cyp4f39 UTSW 17 32491829 missense probably damaging 1.00
R7311:Cyp4f39 UTSW 17 32489655 missense probably damaging 1.00
R7341:Cyp4f39 UTSW 17 32486954 missense probably damaging 1.00
R7345:Cyp4f39 UTSW 17 32486779 missense probably damaging 1.00
R7405:Cyp4f39 UTSW 17 32481815 missense probably benign 0.01
R7522:Cyp4f39 UTSW 17 32486972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTCTGTTTGTCGTTATG -3'
(R):5'- AATGAGTGCAATTCCCAGCTG -3'

Sequencing Primer
(F):5'- TATGCAACGGACTCTGTGC -3'
(R):5'- AATTCCCAGCTGGCCTCTAGG -3'
Posted On2018-04-02