Incidental Mutation 'R6312:Gng3'
ID509850
Institutional Source Beutler Lab
Gene Symbol Gng3
Ensembl Gene ENSMUSG00000071658
Gene Nameguanine nucleotide binding protein (G protein), gamma 3
Synonyms83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8836929-8839246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8838633 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000093978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086058] [ENSMUST00000096259] [ENSMUST00000096753] [ENSMUST00000159634] [ENSMUST00000160556] [ENSMUST00000160897] [ENSMUST00000171649]
Predicted Effect probably benign
Transcript: ENSMUST00000086058
SMART Domains Protein: ENSMUSP00000083224
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096259
AA Change: V7A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000093978
Gene: ENSMUSG00000071658
AA Change: V7A

DomainStartEndE-ValueType
G_gamma 9 75 1.21e-24 SMART
GGL 13 75 1.68e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096753
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159571
Predicted Effect probably benign
Transcript: ENSMUST00000159634
SMART Domains Protein: ENSMUSP00000125422
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159770
Predicted Effect probably benign
Transcript: ENSMUST00000160556
SMART Domains Protein: ENSMUSP00000123976
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160897
SMART Domains Protein: ENSMUSP00000125250
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 97 208 2.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162580
Predicted Effect probably benign
Transcript: ENSMUST00000171649
SMART Domains Protein: ENSMUSP00000127685
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 99 302 8.5e-66 PFAM
Blast:PAC 329 366 2e-6 BLAST
low complexity region 413 431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice display handling- and noise-induced seizures resulting in premature death and reduced growth. Female homozygotes also display reduced inguinal and retroperitoneal fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Gng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Gng3 APN 19 8838580 missense probably benign 0.01
R4981:Gng3 UTSW 19 8838261 missense possibly damaging 0.89
R7092:Gng3 UTSW 19 8838247 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTTCTGCCACTGACCTCAG -3'
(R):5'- ATTTGATGACCAGGACCCAG -3'

Sequencing Primer
(F):5'- CCACTGACCTCAGGGTGTCAAG -3'
(R):5'- CCCAGGGGTTAGGAGAATATTTC -3'
Posted On2018-04-02