Incidental Mutation 'R6312:Tectb'
ID509851
Institutional Source Beutler Lab
Gene Symbol Tectb
Ensembl Gene ENSMUSG00000024979
Gene Nametectorin beta
Synonyms[b]-tectorin, Tctnb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6312 (G1)
Quality Score214.458
Status Not validated
Chromosome19
Chromosomal Location55180733-55196313 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CT to C at 55192662 bp
ZygosityHomozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000120936] [ENSMUST00000154886]
Predicted Effect probably benign
Transcript: ENSMUST00000025936
SMART Domains Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 283 3.47e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120936
SMART Domains Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 293 1.9e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123763
Predicted Effect probably null
Transcript: ENSMUST00000124545
SMART Domains Protein: ENSMUSP00000117645
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 116 5.9e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148123
Predicted Effect probably benign
Transcript: ENSMUST00000154886
SMART Domains Protein: ENSMUSP00000121767
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 196 6.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Tectb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Tectb APN 19 55184013 missense probably damaging 1.00
IGL02001:Tectb APN 19 55189595 missense possibly damaging 0.48
IGL02510:Tectb APN 19 55191511 missense probably damaging 1.00
BB010:Tectb UTSW 19 55194673 missense possibly damaging 0.87
BB020:Tectb UTSW 19 55194673 missense possibly damaging 0.87
R0028:Tectb UTSW 19 55194677 missense probably benign 0.01
R0130:Tectb UTSW 19 55181961 missense probably damaging 0.99
R0586:Tectb UTSW 19 55181924 missense probably damaging 1.00
R0598:Tectb UTSW 19 55189586 nonsense probably null
R0655:Tectb UTSW 19 55189870 missense possibly damaging 0.78
R0708:Tectb UTSW 19 55191552 missense probably benign 0.37
R1314:Tectb UTSW 19 55183985 missense probably damaging 1.00
R1999:Tectb UTSW 19 55180999 start gained probably benign
R2000:Tectb UTSW 19 55180999 start gained probably benign
R2024:Tectb UTSW 19 55181929 missense probably damaging 1.00
R2148:Tectb UTSW 19 55180999 start gained probably benign
R2159:Tectb UTSW 19 55180999 start gained probably benign
R2160:Tectb UTSW 19 55180999 start gained probably benign
R2161:Tectb UTSW 19 55180999 start gained probably benign
R2162:Tectb UTSW 19 55180999 start gained probably benign
R2355:Tectb UTSW 19 55180999 start gained probably benign
R2358:Tectb UTSW 19 55180999 start gained probably benign
R2495:Tectb UTSW 19 55180999 start gained probably benign
R2497:Tectb UTSW 19 55180999 start gained probably benign
R2511:Tectb UTSW 19 55180999 start gained probably benign
R2568:Tectb UTSW 19 55180999 start gained probably benign
R2570:Tectb UTSW 19 55180999 start gained probably benign
R2848:Tectb UTSW 19 55180999 start gained probably benign
R2897:Tectb UTSW 19 55180999 start gained probably benign
R2898:Tectb UTSW 19 55180999 start gained probably benign
R3712:Tectb UTSW 19 55180999 start gained probably benign
R5671:Tectb UTSW 19 55192627 missense probably benign 0.42
R5875:Tectb UTSW 19 55189626 missense possibly damaging 0.94
R6315:Tectb UTSW 19 55191472 missense possibly damaging 0.73
R6366:Tectb UTSW 19 55181918 missense probably damaging 1.00
R7729:Tectb UTSW 19 55192672 missense
R7933:Tectb UTSW 19 55194673 missense possibly damaging 0.87
R8408:Tectb UTSW 19 55189667 critical splice donor site probably null
R8557:Tectb UTSW 19 55192673 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCGACTGGACGACTTTGAC -3'
(R):5'- TGCACCATCACTTTGGAAGCTC -3'

Sequencing Primer
(F):5'- ACTGGACGACTTTGACTCCTTGAAG -3'
(R):5'- ACTTTGGAAGCTCAGCTCCG -3'
Posted On2018-04-02