Mutagenetix > Incidental Mutations

Incidental Mutation 'U24488:Slc4a10'

509856

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

U24488 (G0')

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62046658 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 5 (D5G)

Ref Sequence

ENSEMBL: ENSMUSP00000061411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

Predicted Effect

probably benign
Transcript: ENSMUST00000054484
AA Change: D5G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: D5G

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102735
AA Change: D5G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: D5G

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112480
AA Change: D5G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: D5G

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155219

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	T	15: 8,182,210	G345C	probably damaging	Het
AF529169	C	A	9: 89,603,047	G99V	probably damaging	Het
Ankrd36	A	G	11: 5,630,772	Y922C	probably damaging	Het
Arhgef40	A	G	14: 51,998,216	T1185A	probably benign	Het
Atf7ip2	A	G	16: 10,204,673	N72S	probably damaging	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Ccdc171	A	T	4: 83,661,717	E567V	probably damaging	Het
Chmp1b	T	A	18: 67,205,874	L125Q	probably damaging	Het
Cnr1	T	A	4: 33,944,927	N438K	probably benign	Het
Csmd3	G	A	15: 47,710,399	T2091M	probably damaging	Het
Cyp4a29	A	T	4: 115,251,007	H342L	possibly damaging	Het
D430042O09Rik	A	T	7: 125,770,681	D147V	probably damaging	Het
Dnah10	G	A	5: 124,813,980	D3212N	probably damaging	Het
Dnah2	G	A	11: 69,483,822	T1447I	probably damaging	Het
F11	A	G	8: 45,242,312	S540P	probably benign	Het
Fam71d	A	T	12: 78,715,037	K158N	probably damaging	Het
Fcrl6	T	A	1: 172,598,870	H120L	probably damaging	Het
Frmd6	T	C	12: 70,893,879	S433P	probably damaging	Het
Fundc1	G	T	X: 17,568,103	A64E	probably damaging	Het
Grid1	A	G	14: 35,580,577	E933G	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hoxb3	C	A	11: 96,344,630	Q128K	probably benign	Het
Il6st	C	T	13: 112,494,634	T369M	possibly damaging	Het
Itk	A	C	11: 46,338,144	M403R	probably damaging	Het
Kif2c	T	C	4: 117,182,442	Q17R	probably benign	Het
Kifap3	T	C	1: 163,783,035	I28T	possibly damaging	Het
Kit	A	T	5: 75,623,014	R384*	probably null	Het
Ksr1	T	A	11: 79,047,441	I42F	probably damaging	Het
Lhcgr	T	A	17: 88,772,085		probably null	Het
Lrrc36	C	T	8: 105,449,752	H253Y	probably benign	Het
Mad1l1	T	A	5: 140,315,085	N19Y	probably damaging	Het
Marf1	A	T	16: 14,132,366	L1022*	probably null	Het
Mical3	T	G	6: 121,001,496	Q225P	possibly damaging	Het
Myt1l	T	A	12: 29,826,896	M182K	unknown	Het
Nepro	A	G	16: 44,734,586	T342A	probably benign	Het
Nlrp5	A	T	7: 23,418,228	D459V	possibly damaging	Het
Nrcam	C	T	12: 44,537,259	P39S	probably damaging	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Ostm1	A	G	10: 42,679,231	D83G	possibly damaging	Het
Otoa	A	T	7: 121,118,540		probably null	Het
Pi4ka	A	G	16: 17,325,176	I824T	probably damaging	Het
Plec	C	T	15: 76,177,730	R2534H	probably benign	Het
Plin2	A	G	4: 86,662,077	V60A	probably damaging	Het
Rps6ka4	A	G	19: 6,832,356	L367P	probably damaging	Het
Senp7	A	G	16: 56,184,819	N912D	probably damaging	Het
Slc25a21	G	T	12: 56,738,497	N198K	possibly damaging	Het
Tex16	T	C	X: 112,119,118	V438A	probably benign	Het
Tmem37	T	C	1: 120,067,954	Y131C	probably benign	Het
Top2a	A	C	11: 99,022,426	M60R	probably damaging	Het
Ush2a	C	T	1: 188,430,766	T1015I	probably damaging	Het
Vmn1r172	A	T	7: 23,659,746	I19F	probably benign	Het
Vmn1r230	A	C	17: 20,846,752	I68L	probably benign	Het
Vmn2r45	A	C	7: 8,472,362	C556G	probably damaging	Het
Vmn2r54	A	G	7: 12,615,429	I742T	possibly damaging	Het
Vps13c	A	G	9: 67,905,916	K960E	probably benign	Het
Wdcp	T	A	12: 4,850,405	V87E	probably damaging	Het
Wiz	C	T	17: 32,387,675	E29K	probably damaging	Het
Wnk3	C	T	X: 151,209,460	T298I	probably damaging	Het
Yif1b	A	C	7: 29,244,169	Q56P	probably benign	Het
Zbtb25	A	G	12: 76,349,240	W403R	probably benign	Het
Zcrb1	A	T	15: 93,387,634	S155R	probably damaging	Het
Zmym4	A	T	4: 126,925,660	I150K	possibly damaging	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0506:Slc4a10	UTSW	2	62250533	missense	probably benign	0.13
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1848:Slc4a10	UTSW	2	62316606	missense	probably damaging	1.00
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5223:Slc4a10	UTSW	2	62253366	missense	probably damaging	1.00
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7223:Slc4a10	UTSW	2	62268665	missense	probably damaging	0.99
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7449:Slc4a10	UTSW	2	62303946	missense	probably benign
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGTGCAAAACCTGGCC -3'
(R):5'- AGCATTTTGGTCTCCGGAG -3'

Sequencing Primer
(F):5'- GTGCAAAACCTGGCCAGCAG -3'
(R):5'- CATTTTGGTCTCCGGAGATGGG -3'

Posted On

2018-04-02