Incidental Mutation 'U24488:Plin2'
ID509859
Institutional Source Beutler Lab
Gene Symbol Plin2
Ensembl Gene ENSMUSG00000028494
Gene Nameperilipin 2
Synonymsadipophilin, Adrp, Adfp, ADPH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location86648386-86670060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86662077 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000119063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]
Predicted Effect probably damaging
Transcript: ENSMUST00000000466
AA Change: V149A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: V149A

DomainStartEndE-ValueType
Pfam:Perilipin 6 393 5.3e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138605
Predicted Effect probably damaging
Transcript: ENSMUST00000140382
AA Change: V149A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494
AA Change: V149A

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147097
AA Change: V60A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494
AA Change: V60A

DomainStartEndE-ValueType
Pfam:Perilipin 1 157 3.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149700
AA Change: V149A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494
AA Change: V149A

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154999
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Plin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Plin2 APN 4 86664446 missense possibly damaging 0.88
IGL02501:Plin2 APN 4 86664486 nonsense probably null
IGL02551:Plin2 APN 4 86658692 missense probably benign 0.00
IGL03294:Plin2 APN 4 86662078 missense probably damaging 0.96
R1484:Plin2 UTSW 4 86657244 missense probably benign 0.00
R2165:Plin2 UTSW 4 86668432 missense probably damaging 1.00
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2873:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R3125:Plin2 UTSW 4 86657144 nonsense probably null
R4948:Plin2 UTSW 4 86661991 missense probably benign 0.00
R5189:Plin2 UTSW 4 86657146 missense probably damaging 1.00
R5563:Plin2 UTSW 4 86662104 missense probably benign 0.01
R6229:Plin2 UTSW 4 86668666 missense probably benign
R6258:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6260:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6391:Plin2 UTSW 4 86661999 missense probably null 0.99
R6470:Plin2 UTSW 4 86668370 missense probably damaging 1.00
R6493:Plin2 UTSW 4 86661987 missense possibly damaging 0.80
R6562:Plin2 UTSW 4 86658595 missense probably benign 0.07
R6706:Plin2 UTSW 4 86660120 missense probably benign 0.02
R7310:Plin2 UTSW 4 86668391 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTCTGAGTGAGAGTGTCCC -3'
(R):5'- TAAGCCGGCTTGTCTGTTTC -3'

Sequencing Primer
(F):5'- GTCTGCTTTTCAAGTAACAGGCCAG -3'
(R):5'- CTTTGCTTACAGATTGTTGCCAG -3'
Posted On2018-04-02