Incidental Mutation 'U24488:Mical3'
ID509866
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #U24488 (G0')
Quality Score111.008
Status Not validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121001496 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 225 (Q225P)
Ref Sequence ENSEMBL: ENSMUSP00000144972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204302] [ENSMUST00000207889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150503
SMART Domains Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
SCOP:d1bjt__ 41 141 8e-3 SMART
coiled coil region 192 219 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 328 337 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 536 546 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 748 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203013
Predicted Effect possibly damaging
Transcript: ENSMUST00000204302
AA Change: Q225P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144972
Gene: ENSMUSG00000051586
AA Change: Q225P

DomainStartEndE-ValueType
LIM 82 136 5.39e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207889
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 intron probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACCTCGGTGTGTCTTG -3'
(R):5'- GACTCTTCTAGGAAGTCAAAGGAG -3'

Sequencing Primer
(F):5'- CTTGTGGGTTGTGGGGGTAAC -3'
(R):5'- CTTCTAGGAAGTCAAAGGAGCCCTG -3'
Posted On2018-04-02