Incidental Mutation 'U24488:Itk'
ID509882
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46338144 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 403 (M403R)
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000020664
AA Change: M397R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: M397R

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109237
AA Change: M403R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: M403R

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148132
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCTAGGCCCTAACAAGG -3'
(R):5'- TACCTATGACACTCTAAGCCATCTTTG -3'

Sequencing Primer
(F):5'- CCCTAACAAGGCTCTTTTTGTG -3'
(R):5'- ACGTTCGTGCAGGAGAT -3'
Posted On2018-04-02