Incidental Mutation 'U24488:Slc25a21'
ID509890
Institutional Source Beutler Lab
Gene Symbol Slc25a21
Ensembl Gene ENSMUSG00000035472
Gene Namesolute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms9930033G19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location56712634-57197472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56738497 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 198 (N198K)
Ref Sequence ENSEMBL: ENSMUSP00000151751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044634] [ENSMUST00000110680] [ENSMUST00000217690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044634
AA Change: N191K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472
AA Change: N191K

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110680
AA Change: N198K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106308
Gene: ENSMUSG00000035472
AA Change: N198K

DomainStartEndE-ValueType
Pfam:Mito_carr 28 111 4.7e-21 PFAM
Pfam:Mito_carr 114 207 7.7e-17 PFAM
Pfam:Mito_carr 209 305 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160709
Predicted Effect possibly damaging
Transcript: ENSMUST00000217690
AA Change: N198K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Slc25a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc25a21 APN 12 56718137 splice site probably null
IGL00776:Slc25a21 APN 12 56770205 missense probably benign 0.43
IGL00788:Slc25a21 APN 12 56713812 utr 3 prime probably benign
IGL01396:Slc25a21 APN 12 57159189 missense probably benign
IGL01656:Slc25a21 APN 12 56738495 missense probably damaging 1.00
IGL03095:Slc25a21 APN 12 56738625 missense probably benign 0.09
R0285:Slc25a21 UTSW 12 56858025 critical splice donor site probably null
R1238:Slc25a21 UTSW 12 56738487 missense probably benign 0.00
R1509:Slc25a21 UTSW 12 56858079 missense probably benign 0.00
R1803:Slc25a21 UTSW 12 56858087 missense probably benign 0.01
R3862:Slc25a21 UTSW 12 56718135 splice site probably benign
R4684:Slc25a21 UTSW 12 57196936 missense probably benign 0.00
R4816:Slc25a21 UTSW 12 56713838 missense probably damaging 1.00
R5718:Slc25a21 UTSW 12 56718156 missense probably benign 0.00
R6265:Slc25a21 UTSW 12 57196900 missense probably benign 0.33
R6953:Slc25a21 UTSW 12 57159169 missense probably benign
R7337:Slc25a21 UTSW 12 56858043 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTCGGAAGTCTCAGTTTCTGG -3'
(R):5'- TAGTCTGTTGCCTCCCATGG -3'

Sequencing Primer
(F):5'- CTCAGTTTCTGGATTTGAAAAGGAC -3'
(R):5'- CATGGTCCCAAAATGATGTCTC -3'
Posted On2018-04-02