Incidental Mutation 'U24488:Carmil3'
ID509897
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Namecapping protein regulator and myosin 1 linker 3
SynonymsLrrc16b
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55490651-55508272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55497179 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 455 (D455G)
Ref Sequence ENSEMBL: ENSMUSP00000075587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect probably benign
Transcript: ENSMUST00000076236
AA Change: D455G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: D455G

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226446
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Meta Mutation Damage Score 0.1640 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55498298 missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55501895 critical splice donor site probably null
IGL01061:Carmil3 APN 14 55498630 missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55496058 missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55493849 missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55494227 missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55493536 missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55493822 splice site probably benign
IGL02160:Carmil3 APN 14 55493558 missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55504517 missense probably benign 0.00
IGL02567:Carmil3 APN 14 55498882 missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55499068 missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55507410 missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55494718 missense probably damaging 0.99
PIT4434001:Carmil3 UTSW 14 55494688 missense probably null 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55494403 missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55497755 splice site probably benign
R0321:Carmil3 UTSW 14 55502241 missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55495442 missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55499861 missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55502435 critical splice donor site probably null
R1503:Carmil3 UTSW 14 55498280 missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55496282 missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55504532 missense probably benign 0.02
R1923:Carmil3 UTSW 14 55502404 missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55498630 missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55503838 missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55498313 missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55507694 missense probably benign 0.05
R3552:Carmil3 UTSW 14 55507402 missense possibly damaging 0.86
R3783:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R3787:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55503955 missense probably benign 0.10
R4285:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55493588 missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55501471 missense probably benign
R4506:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55505664 splice site probably null
R4574:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R4784:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R5146:Carmil3 UTSW 14 55497179 missense probably benign 0.02
R5279:Carmil3 UTSW 14 55501571 missense probably damaging 0.98
R5425:Carmil3 UTSW 14 55493877 missense probably benign 0.41
R5530:Carmil3 UTSW 14 55493624 missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55494890 missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55503999 frame shift probably null
R5772:Carmil3 UTSW 14 55493239 missense probably damaging 1.00
R5896:Carmil3 UTSW 14 55503999 frame shift probably null
R5931:Carmil3 UTSW 14 55498940 missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55503845 missense probably benign 0.00
R6103:Carmil3 UTSW 14 55505427 missense probably benign 0.02
R6258:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55507930 missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55501561 missense probably benign 0.04
R7164:Carmil3 UTSW 14 55501282 missense probably damaging 0.98
R7214:Carmil3 UTSW 14 55498612 missense probably damaging 1.00
R7223:Carmil3 UTSW 14 55496238 missense possibly damaging 0.48
R7269:Carmil3 UTSW 14 55493895 missense probably benign 0.03
R7319:Carmil3 UTSW 14 55494360 missense probably benign 0.13
R7357:Carmil3 UTSW 14 55491133 start gained probably benign
R7386:Carmil3 UTSW 14 55497747 critical splice donor site probably null
R7463:Carmil3 UTSW 14 55502396 missense probably damaging 1.00
R7598:Carmil3 UTSW 14 55494821 missense possibly damaging 0.61
R7602:Carmil3 UTSW 14 55501508 missense probably null 0.00
R7617:Carmil3 UTSW 14 55497891 missense probably benign 0.06
Z1088:Carmil3 UTSW 14 55501568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCAATTCTTCAGCAGCG -3'
(R):5'- AGAGAGCTATTCCCTGTTTCTGC -3'

Sequencing Primer
(F):5'- TGAGCCATGTCAACCTGTCAG -3'
(R):5'- GCTCTCCACTCTGTGTGTGTG -3'
Posted On2018-04-02