Incidental Mutation 'U24488:Atf7ip2'
ID509902
Institutional Source Beutler Lab
Gene Symbol Atf7ip2
Ensembl Gene ENSMUSG00000039200
Gene Nameactivating transcription factor 7 interacting protein 2
Synonyms4930558K11Rik, PSM2, Get-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location10192712-10251478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10204673 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000113480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044005] [ENSMUST00000100191] [ENSMUST00000117220] [ENSMUST00000119023]
Predicted Effect probably benign
Transcript: ENSMUST00000044005
AA Change: N72S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200
AA Change: N72S

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100191
AA Change: N72S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097766
Gene: ENSMUSG00000039200
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117220
AA Change: N72S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113573
Gene: ENSMUSG00000039200
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119023
AA Change: N72S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113480
Gene: ENSMUSG00000039200
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230210
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Atf7ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Atf7ip2 APN 16 10241885 missense probably damaging 0.99
IGL01937:Atf7ip2 APN 16 10241537 splice site probably null
IGL02301:Atf7ip2 APN 16 10211047 missense probably benign 0.32
R0575:Atf7ip2 UTSW 16 10237211 missense probably damaging 1.00
R0671:Atf7ip2 UTSW 16 10241879 missense possibly damaging 0.86
R1119:Atf7ip2 UTSW 16 10240612 missense possibly damaging 0.83
R1182:Atf7ip2 UTSW 16 10241835 missense possibly damaging 0.93
R1302:Atf7ip2 UTSW 16 10240608 missense possibly damaging 0.84
R1346:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1349:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1372:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1672:Atf7ip2 UTSW 16 10209141 missense probably damaging 1.00
R1696:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1897:Atf7ip2 UTSW 16 10211084 missense probably damaging 0.97
R1932:Atf7ip2 UTSW 16 10241703 missense possibly damaging 0.86
R2143:Atf7ip2 UTSW 16 10240645 missense probably null 0.68
R4612:Atf7ip2 UTSW 16 10241563 missense probably benign 0.33
R4732:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4733:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4934:Atf7ip2 UTSW 16 10241583 missense possibly damaging 0.72
R6137:Atf7ip2 UTSW 16 10201411 missense probably damaging 0.99
R6432:Atf7ip2 UTSW 16 10204670 missense probably damaging 1.00
R7298:Atf7ip2 UTSW 16 10209168 missense possibly damaging 0.82
R7517:Atf7ip2 UTSW 16 10241535 splice site probably null
X0062:Atf7ip2 UTSW 16 10209274 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTACTGCTGTTGTCACATTATAG -3'
(R):5'- TGGGAGGTACACAAGAACCATC -3'

Sequencing Primer
(F):5'- CTCTCTTCAAGGTCATAATCAG -3'
(R):5'- ACATGGATGCTGGGAACTGATCTC -3'
Posted On2018-04-02