Incidental Mutation 'U24488:Nepro'
ID509905
Institutional Source Beutler Lab
Gene Symbol Nepro
Ensembl Gene ENSMUSG00000036208
Gene Namenucleolus and neural progenitor protein
SynonymsBC027231
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44724301-44737284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44734586 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 342 (T342A)
Ref Sequence ENSEMBL: ENSMUSP00000038779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023348] [ENSMUST00000048788] [ENSMUST00000123673] [ENSMUST00000147804] [ENSMUST00000161436] [ENSMUST00000162512]
Predicted Effect probably benign
Transcript: ENSMUST00000023348
SMART Domains Protein: ENSMUSP00000023348
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:SRPRB 42 164 4.1e-7 PFAM
Pfam:GTP_EFTU 42 214 3.4e-9 PFAM
Pfam:FeoB_N 45 208 5.9e-6 PFAM
Pfam:MMR_HSR1 46 161 5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048788
AA Change: T342A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000038779
Gene: ENSMUSG00000036208
AA Change: T342A

DomainStartEndE-ValueType
Pfam:DUF4477 12 202 3.2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130805
Predicted Effect probably benign
Transcript: ENSMUST00000132610
SMART Domains Protein: ENSMUSP00000116115
Gene: ENSMUSG00000036208

DomainStartEndE-ValueType
Pfam:DUF4477 1 118 7.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147804
Predicted Effect probably benign
Transcript: ENSMUST00000161436
SMART Domains Protein: ENSMUSP00000123974
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:GTP_EFTU 65 230 5.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162512
SMART Domains Protein: ENSMUSP00000125352
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:SRPRB 109 250 1.8e-7 PFAM
Pfam:MMR_HSR1 113 228 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to implantation with a failure to form a blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Nepro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Nepro APN 16 44729305 nonsense probably null
IGL01688:Nepro APN 16 44736006 missense probably damaging 0.97
IGL03149:Nepro APN 16 44727099 missense probably damaging 1.00
IGL03046:Nepro UTSW 16 44732146 unclassified probably benign
R0839:Nepro UTSW 16 44736019 missense probably benign 0.27
R1619:Nepro UTSW 16 44727028 missense probably benign 0.01
R1777:Nepro UTSW 16 44735853 missense probably damaging 0.99
R4273:Nepro UTSW 16 44735829 missense possibly damaging 0.47
R4487:Nepro UTSW 16 44735726 missense probably damaging 1.00
R4750:Nepro UTSW 16 44730182 missense probably damaging 1.00
R4841:Nepro UTSW 16 44734797 missense probably null 1.00
R4842:Nepro UTSW 16 44734797 missense probably null 1.00
R4869:Nepro UTSW 16 44730173 missense probably damaging 1.00
R4973:Nepro UTSW 16 44734793 missense probably benign 0.16
R4988:Nepro UTSW 16 44734542 missense possibly damaging 0.95
R6480:Nepro UTSW 16 44727075 missense probably damaging 1.00
R6830:Nepro UTSW 16 44731357 missense probably damaging 1.00
R7149:Nepro UTSW 16 44729715 critical splice donor site probably null
R8024:Nepro UTSW 16 44731415 missense probably benign 0.05
X0067:Nepro UTSW 16 44734703 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TAGGACTTGCCTCTGTAGAAGG -3'
(R):5'- AGAAGTTTGTTGCCCAGAAAGG -3'

Sequencing Primer
(F):5'- ACTTGCCTCTGTAGAAGGATAAAG -3'
(R):5'- TTGTTGCCCAGAAAGGTAGCC -3'
Posted On2018-04-02