Incidental Mutation 'U24488:Lhcgr'
ID509909
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Nameluteinizing hormone/choriogonadotropin receptor
SynonymsLhr, LH-R, Gpcr19-rs1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location88741549-88791976 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 88772085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
Predicted Effect probably null
Transcript: ENSMUST00000024916
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Rps6ka4 A G 19: 6,832,356 L367P probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 88742446 missense probably benign
IGL00661:Lhcgr APN 17 88750118 missense probably benign
IGL00840:Lhcgr APN 17 88753736 splice site probably benign
IGL01434:Lhcgr APN 17 88742437 missense probably damaging 1.00
IGL01489:Lhcgr APN 17 88764973 splice site probably benign
IGL02077:Lhcgr APN 17 88750130 missense probably benign 0.06
IGL02533:Lhcgr APN 17 88742410 missense probably benign 0.00
IGL02948:Lhcgr APN 17 88742622 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0556:Lhcgr UTSW 17 88772063 missense probably damaging 0.99
R1824:Lhcgr UTSW 17 88750157 missense probably benign 0.00
R1846:Lhcgr UTSW 17 88765147 critical splice donor site probably null
R1852:Lhcgr UTSW 17 88765176 missense probably damaging 0.99
R2352:Lhcgr UTSW 17 88742299 missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 88758343 missense probably damaging 0.96
R3756:Lhcgr UTSW 17 88753856 missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 88742283 missense probably damaging 1.00
R4540:Lhcgr UTSW 17 88755608 missense probably benign
R4688:Lhcgr UTSW 17 88765152 missense probably damaging 0.99
R4717:Lhcgr UTSW 17 88742467 missense probably benign 0.00
R4723:Lhcgr UTSW 17 88742602 missense probably benign 0.09
R4776:Lhcgr UTSW 17 88742697 missense probably damaging 1.00
R4903:Lhcgr UTSW 17 88742361 missense probably damaging 1.00
R5195:Lhcgr UTSW 17 88742946 missense probably damaging 1.00
R5231:Lhcgr UTSW 17 88755611 missense probably damaging 1.00
R5361:Lhcgr UTSW 17 88742853 missense probably damaging 1.00
R5683:Lhcgr UTSW 17 88772019 missense probably benign 0.00
R5758:Lhcgr UTSW 17 88742548 missense probably damaging 0.99
R5929:Lhcgr UTSW 17 88743008 nonsense probably null
R5987:Lhcgr UTSW 17 88755578 missense probably damaging 1.00
R6268:Lhcgr UTSW 17 88742704 missense probably damaging 1.00
R6477:Lhcgr UTSW 17 88742373 missense probably damaging 1.00
R6610:Lhcgr UTSW 17 88769879 missense possibly damaging 0.93
R7234:Lhcgr UTSW 17 88791931 missense possibly damaging 0.96
R7282:Lhcgr UTSW 17 88758383 missense probably benign
R7320:Lhcgr UTSW 17 88742078 missense probably benign
R7398:Lhcgr UTSW 17 88772046 missense probably benign 0.03
R7710:Lhcgr UTSW 17 88742782 missense probably damaging 1.00
R8034:Lhcgr UTSW 17 88742356 missense probably damaging 1.00
X0028:Lhcgr UTSW 17 88742722 missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 88742270 missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 88753905 missense probably benign 0.00
Z1177:Lhcgr UTSW 17 88764981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTTTCCTAAACACAGTTTCTC -3'
(R):5'- CTCGATGAAATCTCTCAACAAGATAGG -3'

Sequencing Primer
(F):5'- TTTCCTAAACACAGTTTCTCTCTTAG -3'
(R):5'- AATCTCTCAACAAGATAGGAATTGC -3'
Posted On2018-04-02