Incidental Mutation 'U24488:Rps6ka4'
ID509911
Institutional Source Beutler Lab
Gene Symbol Rps6ka4
Ensembl Gene ENSMUSG00000024952
Gene Nameribosomal protein S6 kinase, polypeptide 4
Synonyms1110069D02Rik, MSK2, 90kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #U24488 (G0')
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6829085-6840601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6832356 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 367 (L367P)
Ref Sequence ENSEMBL: ENSMUSP00000131581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025903] [ENSMUST00000170516]
Predicted Effect probably damaging
Transcript: ENSMUST00000025903
AA Change: L367P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025903
Gene: ENSMUSG00000024952
AA Change: L367P

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170516
AA Change: L367P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131581
Gene: ENSMUSG00000024952
AA Change: L367P

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199140
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and ATF1. The encoded protein can also phosphorylate histone H3 to regulate certain inflammatory genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: No phenotypic information associated with mutations in this gene have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,182,210 G345C probably damaging Het
AF529169 C A 9: 89,603,047 G99V probably damaging Het
Ankrd36 A G 11: 5,630,772 Y922C probably damaging Het
Arhgef40 A G 14: 51,998,216 T1185A probably benign Het
Atf7ip2 A G 16: 10,204,673 N72S probably damaging Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Ccdc171 A T 4: 83,661,717 E567V probably damaging Het
Chmp1b T A 18: 67,205,874 L125Q probably damaging Het
Cnr1 T A 4: 33,944,927 N438K probably benign Het
Csmd3 G A 15: 47,710,399 T2091M probably damaging Het
Cyp4a29 A T 4: 115,251,007 H342L possibly damaging Het
D430042O09Rik A T 7: 125,770,681 D147V probably damaging Het
Dnah10 G A 5: 124,813,980 D3212N probably damaging Het
Dnah2 G A 11: 69,483,822 T1447I probably damaging Het
F11 A G 8: 45,242,312 S540P probably benign Het
Fam71d A T 12: 78,715,037 K158N probably damaging Het
Fcrl6 T A 1: 172,598,870 H120L probably damaging Het
Frmd6 T C 12: 70,893,879 S433P probably damaging Het
Fundc1 G T X: 17,568,103 A64E probably damaging Het
Grid1 A G 14: 35,580,577 E933G probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hoxb3 C A 11: 96,344,630 Q128K probably benign Het
Il6st C T 13: 112,494,634 T369M possibly damaging Het
Itk A C 11: 46,338,144 M403R probably damaging Het
Kif2c T C 4: 117,182,442 Q17R probably benign Het
Kifap3 T C 1: 163,783,035 I28T possibly damaging Het
Kit A T 5: 75,623,014 R384* probably null Het
Ksr1 T A 11: 79,047,441 I42F probably damaging Het
Lhcgr T A 17: 88,772,085 probably null Het
Lrrc36 C T 8: 105,449,752 H253Y probably benign Het
Mad1l1 T A 5: 140,315,085 N19Y probably damaging Het
Marf1 A T 16: 14,132,366 L1022* probably null Het
Mical3 T G 6: 121,001,496 Q225P possibly damaging Het
Myt1l T A 12: 29,826,896 M182K unknown Het
Nepro A G 16: 44,734,586 T342A probably benign Het
Nlrp5 A T 7: 23,418,228 D459V possibly damaging Het
Nrcam C T 12: 44,537,259 P39S probably damaging Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Ostm1 A G 10: 42,679,231 D83G possibly damaging Het
Otoa A T 7: 121,118,540 probably null Het
Pi4ka A G 16: 17,325,176 I824T probably damaging Het
Plec C T 15: 76,177,730 R2534H probably benign Het
Plin2 A G 4: 86,662,077 V60A probably damaging Het
Senp7 A G 16: 56,184,819 N912D probably damaging Het
Slc25a21 G T 12: 56,738,497 N198K possibly damaging Het
Slc4a10 A G 2: 62,046,658 D5G probably benign Het
Tex16 T C X: 112,119,118 V438A probably benign Het
Tmem37 T C 1: 120,067,954 Y131C probably benign Het
Top2a A C 11: 99,022,426 M60R probably damaging Het
Ush2a C T 1: 188,430,766 T1015I probably damaging Het
Vmn1r172 A T 7: 23,659,746 I19F probably benign Het
Vmn1r230 A C 17: 20,846,752 I68L probably benign Het
Vmn2r45 A C 7: 8,472,362 C556G probably damaging Het
Vmn2r54 A G 7: 12,615,429 I742T possibly damaging Het
Vps13c A G 9: 67,905,916 K960E probably benign Het
Wdcp T A 12: 4,850,405 V87E probably damaging Het
Wiz C T 17: 32,387,675 E29K probably damaging Het
Wnk3 C T X: 151,209,460 T298I probably damaging Het
Yif1b A C 7: 29,244,169 Q56P probably benign Het
Zbtb25 A G 12: 76,349,240 W403R probably benign Het
Zcrb1 A T 15: 93,387,634 S155R probably damaging Het
Zmym4 A T 4: 126,925,660 I150K possibly damaging Het
Other mutations in Rps6ka4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Rps6ka4 APN 19 6831128 missense probably damaging 1.00
IGL01548:Rps6ka4 APN 19 6832323 missense probably benign 0.02
IGL02536:Rps6ka4 APN 19 6832071 missense probably damaging 1.00
IGL02902:Rps6ka4 APN 19 6832255 critical splice donor site probably null
IGL03299:Rps6ka4 APN 19 6832247 splice site probably benign
R0510:Rps6ka4 UTSW 19 6840498 missense probably benign 0.13
R1104:Rps6ka4 UTSW 19 6830996 missense probably damaging 1.00
R1620:Rps6ka4 UTSW 19 6838149 missense probably damaging 1.00
R1647:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1648:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1939:Rps6ka4 UTSW 19 6839466 missense probably damaging 1.00
R2370:Rps6ka4 UTSW 19 6830100 missense possibly damaging 0.93
R2412:Rps6ka4 UTSW 19 6829941 makesense probably null
R2571:Rps6ka4 UTSW 19 6838103 missense probably damaging 1.00
R2698:Rps6ka4 UTSW 19 6837352 missense probably benign 0.08
R3427:Rps6ka4 UTSW 19 6837755 critical splice donor site probably null
R3721:Rps6ka4 UTSW 19 6839277 missense possibly damaging 0.73
R3844:Rps6ka4 UTSW 19 6837803 nonsense probably null
R4092:Rps6ka4 UTSW 19 6832255 critical splice donor site probably null
R4169:Rps6ka4 UTSW 19 6831820 missense possibly damaging 0.92
R4677:Rps6ka4 UTSW 19 6839486 missense probably damaging 1.00
R4897:Rps6ka4 UTSW 19 6838099 missense probably benign 0.02
R4975:Rps6ka4 UTSW 19 6840310 unclassified probably null
R5631:Rps6ka4 UTSW 19 6830977 splice site probably benign
R6462:Rps6ka4 UTSW 19 6837589 missense possibly damaging 0.90
R6643:Rps6ka4 UTSW 19 6832363 missense probably damaging 1.00
R6939:Rps6ka4 UTSW 19 6838069 missense probably damaging 1.00
R7030:Rps6ka4 UTSW 19 6839624 missense probably damaging 1.00
R7902:Rps6ka4 UTSW 19 6831311 missense possibly damaging 0.81
R7985:Rps6ka4 UTSW 19 6831311 missense possibly damaging 0.81
X0019:Rps6ka4 UTSW 19 6838140 missense probably damaging 0.97
X0027:Rps6ka4 UTSW 19 6837772 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TATGAGTGGCCCTGTCATGG -3'
(R):5'- TGGCCCCAAGTAATCATAAACAGG -3'

Sequencing Primer
(F):5'- CAGCAACCGGTGGAACTG -3'
(R):5'- GGTAGGATAAGATGTGTCCACAC -3'
Posted On2018-04-02