Incidental Mutation 'R6314:Tor4a'
ID509919
Institutional Source Beutler Lab
Gene Symbol Tor4a
Ensembl Gene ENSMUSG00000059555
Gene Nametorsin family 4, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25192966-25196886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25194782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 370 (R370G)
Ref Sequence ENSEMBL: ENSMUSP00000080548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849] [ENSMUST00000081869] [ENSMUST00000137920] [ENSMUST00000142857]
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081869
AA Change: R370G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080548
Gene: ENSMUSG00000059555
AA Change: R370G

DomainStartEndE-ValueType
low complexity region 21 40 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
AAA 181 317 3.74e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect probably benign
Transcript: ENSMUST00000137920
Predicted Effect probably benign
Transcript: ENSMUST00000142857
SMART Domains Protein: ENSMUSP00000142048
Gene: ENSMUSG00000059555

DomainStartEndE-ValueType
Pfam:Torsin 1 86 4.2e-9 PFAM
Pfam:AAA_22 12 112 6.7e-8 PFAM
Pfam:AAA_17 18 111 2.4e-7 PFAM
Pfam:AAA 19 110 3.1e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Tor4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Tor4a APN 2 25194798 missense probably benign 0.18
IGL02813:Tor4a APN 2 25194749 nonsense probably null
R1486:Tor4a UTSW 2 25194679 missense possibly damaging 0.47
R1916:Tor4a UTSW 2 25195402 missense possibly damaging 0.83
R2958:Tor4a UTSW 2 25194968 missense possibly damaging 0.93
R5237:Tor4a UTSW 2 25194964 missense probably damaging 0.97
R5356:Tor4a UTSW 2 25195906 intron probably null
R5694:Tor4a UTSW 2 25194920 missense probably benign
R5874:Tor4a UTSW 2 25194835 missense probably damaging 1.00
R6407:Tor4a UTSW 2 25194940 missense probably benign
R7056:Tor4a UTSW 2 25194841 missense probably benign
R7498:Tor4a UTSW 2 25195792 missense probably benign 0.22
R7590:Tor4a UTSW 2 25195798 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAGTGTCCAGCATGTGCAG -3'
(R):5'- TGTACTCCTAAGTGGCGCTG -3'

Sequencing Primer
(F):5'- GCAGGCTTGTGCTGTAAGAG -3'
(R):5'- AAATGCGTCACGGATGTTGCC -3'
Posted On2018-04-02