Incidental Mutation 'R6314:Orc3'
ID509926
Institutional Source Beutler Lab
Gene Symbol Orc3
Ensembl Gene ENSMUSG00000040044
Gene Nameorigin recognition complex, subunit 3
SynonymsOrc3l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location34570796-34614944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34579797 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 494 (G494C)
Ref Sequence ENSEMBL: ENSMUSP00000103777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048706] [ENSMUST00000108142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048706
AA Change: G494C

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048319
Gene: ENSMUSG00000040044
AA Change: G494C

DomainStartEndE-ValueType
Pfam:ORC3_N 25 350 3e-130 PFAM
low complexity region 653 664 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108142
AA Change: G494C

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103777
Gene: ENSMUSG00000040044
AA Change: G494C

DomainStartEndE-ValueType
Pfam:ORC3_N 24 350 7.7e-136 PFAM
low complexity region 652 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156987
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the neural cells exhibit reduced neuronal precursor proliferation and reduced radial glial cell. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Orc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Orc3 APN 4 34595096 missense probably damaging 1.00
IGL03293:Orc3 APN 4 34595210 missense probably damaging 0.96
IGL02991:Orc3 UTSW 4 34593083 missense probably damaging 1.00
R0157:Orc3 UTSW 4 34607130 critical splice donor site probably null
R0708:Orc3 UTSW 4 34597368 missense probably damaging 1.00
R1331:Orc3 UTSW 4 34599748 missense probably benign 0.01
R1481:Orc3 UTSW 4 34607228 missense possibly damaging 0.50
R1755:Orc3 UTSW 4 34575114 missense possibly damaging 0.67
R1886:Orc3 UTSW 4 34584829 missense probably damaging 1.00
R2008:Orc3 UTSW 4 34611049 unclassified probably null
R2054:Orc3 UTSW 4 34584846 missense probably damaging 0.97
R2307:Orc3 UTSW 4 34586503 missense probably damaging 1.00
R3001:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3002:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3153:Orc3 UTSW 4 34575124 missense probably damaging 0.99
R4044:Orc3 UTSW 4 34587055 nonsense probably null
R4814:Orc3 UTSW 4 34572450 splice site probably benign
R4825:Orc3 UTSW 4 34571774 missense possibly damaging 0.95
R4939:Orc3 UTSW 4 34593126 nonsense probably null
R6867:Orc3 UTSW 4 34605539 missense probably damaging 1.00
R7227:Orc3 UTSW 4 34572542 missense probably benign 0.00
R7417:Orc3 UTSW 4 34595136 missense probably damaging 1.00
R7655:Orc3 UTSW 4 34587032 nonsense probably null
R7656:Orc3 UTSW 4 34587032 nonsense probably null
R7707:Orc3 UTSW 4 34598691 nonsense probably null
R7856:Orc3 UTSW 4 34585647 missense probably benign
R7939:Orc3 UTSW 4 34585647 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGCCTTTGCCTGTTTGC -3'
(R):5'- CTTAATTTCTTGTTGGCACCTAGGG -3'

Sequencing Primer
(F):5'- GCACTTGTTAAGATGTTACCTTCAG -3'
(R):5'- TCAGGTTATAAAGTGCCGCC -3'
Posted On2018-04-02