Incidental Mutation 'R6314:Thsd7a'
ID509933
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12554997 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119443
SMART Domains Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 14 70 9.98e-5 SMART
TSP1 77 161 3.14e0 SMART
TSP1 166 225 6.62e-1 SMART
Blast:TSP1 226 262 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: N296S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: N296S

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172356
AA Change: N296S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: N296S

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
Predicted Primers PCR Primer
(F):5'- ATAAGCCTTGCACTAGGGAATATC -3'
(R):5'- TTCAGGTGTGCCAGTCCAAC -3'

Sequencing Primer
(F):5'- CTTTCACAAGGTTATACCAGGAGTC -3'
(R):5'- AACCCCTGCGAGGAGGATG -3'
Posted On2018-04-02