Incidental Mutation 'R6314:6430531B16Rik'
ID509939
Institutional Source Beutler Lab
Gene Symbol 6430531B16Rik
Ensembl Gene ENSMUSG00000073795
Gene NameRIKEN cDNA 6430531B16 gene
SynonymsLOC381933
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139972303-139978755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 139976489 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 195 (L195R)
Ref Sequence ENSEMBL: ENSMUSP00000148257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000097970] [ENSMUST00000106069] [ENSMUST00000121412] [ENSMUST00000209335] [ENSMUST00000210254]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097970
AA Change: L195R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795
AA Change: L195R

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121412
AA Change: L195R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113338
Gene: ENSMUSG00000073795
AA Change: L195R

DomainStartEndE-ValueType
Pfam:DUF1042 22 153 4.5e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.3e-20 PFAM
low complexity region 230 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect possibly damaging
Transcript: ENSMUST00000209335
AA Change: L195R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210254
AA Change: L195R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in 6430531B16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:6430531B16Rik APN 7 139978103 missense probably damaging 1.00
IGL01900:6430531B16Rik APN 7 139972570 missense probably damaging 1.00
IGL03395:6430531B16Rik APN 7 139976676 splice site probably benign
R0562:6430531B16Rik UTSW 7 139977113 missense probably benign 0.01
R1121:6430531B16Rik UTSW 7 139976630 missense probably benign 0.00
R1474:6430531B16Rik UTSW 7 139976642 missense probably benign
R1844:6430531B16Rik UTSW 7 139976092 missense probably benign 0.06
R2680:6430531B16Rik UTSW 7 139978561 missense probably damaging 1.00
R3113:6430531B16Rik UTSW 7 139975965 splice site probably benign
R4478:6430531B16Rik UTSW 7 139975860 critical splice donor site probably null
R4576:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R4577:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R5037:6430531B16Rik UTSW 7 139978674 missense possibly damaging 0.84
R5935:6430531B16Rik UTSW 7 139976613 missense probably benign 0.37
R6361:6430531B16Rik UTSW 7 139976672 missense possibly damaging 0.55
R7326:6430531B16Rik UTSW 7 139978545 critical splice donor site probably null
R7386:6430531B16Rik UTSW 7 139976052 nonsense probably null
R7658:6430531B16Rik UTSW 7 139976618 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCAGGGACCTTTGCATAGC -3'
(R):5'- CTTTGCAGGATCCAAGACACTC -3'

Sequencing Primer
(F):5'- GGACCTTTGCATAGCTCTGGAAAC -3'
(R):5'- ATCCAAGACACTCTGCTGTGGATG -3'
Posted On2018-04-02