Incidental Mutation 'R6314:Ankdd1a'
ID509945
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Nameankyrin repeat and death domain containing 1A
SynonymsLOC384945
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65488470-65520193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65508061 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 227 (A227T)
Ref Sequence ENSEMBL: ENSMUSP00000057040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061766
AA Change: A227T

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: A227T

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217646
AA Change: A237T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65508702 missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65504139 missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65507611 splice site probably benign
IGL02150:Ankdd1a APN 9 65512719 missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65501470 missense probably benign 0.28
PIT4618001:Ankdd1a UTSW 9 65507650 missense possibly damaging 0.76
R0137:Ankdd1a UTSW 9 65510328 missense probably null 0.26
R0302:Ankdd1a UTSW 9 65509642 splice site probably benign
R0980:Ankdd1a UTSW 9 65516971 missense probably damaging 1.00
R1832:Ankdd1a UTSW 9 65504489 critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65502248 missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65505214 missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65502241 missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65509696 missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65520164 missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6313:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6413:Ankdd1a UTSW 9 65510372 missense probably benign
R6431:Ankdd1a UTSW 9 65516938 missense possibly damaging 0.92
R6477:Ankdd1a UTSW 9 65502212 missense probably benign 0.10
R6991:Ankdd1a UTSW 9 65508675 missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65504552 missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65502184 critical splice donor site probably null
X0064:Ankdd1a UTSW 9 65503453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTGCAAAAGGCCCACTGTG -3'
(R):5'- ACCAAGACTCTTGTTCTCACTGG -3'

Sequencing Primer
(F):5'- AGGCCCACTGTGGCCTTTAAC -3'
(R):5'- CAAGACTCTTGTTCTCACTGGTTGAG -3'
Posted On2018-04-02