Incidental Mutation 'R6314:Dnmt3l'
ID509948
Institutional Source Beutler Lab
Gene Symbol Dnmt3l
Ensembl Gene ENSMUSG00000000730
Gene NameDNA (cytosine-5-)-methyltransferase 3-like
SynonymsD6Ertd14e, ecat7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78041947-78063622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78059687 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 58 (Y58F)
Ref Sequence ENSEMBL: ENSMUSP00000119571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]
Predicted Effect probably benign
Transcript: ENSMUST00000000746
AA Change: Y353F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730
AA Change: Y353F

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123940
AA Change: Y58F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730
AA Change: Y58F

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131825
AA Change: Y58F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730
AA Change: Y58F

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138785
AA Change: Y353F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730
AA Change: Y353F

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139539
AA Change: Y58F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730
AA Change: Y58F

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144446
Predicted Effect probably benign
Transcript: ENSMUST00000151242
AA Change: Y353F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730
AA Change: Y353F

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Dnmt3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnmt3l APN 10 78057355 missense probably damaging 1.00
IGL00827:Dnmt3l APN 10 78053996 missense probably damaging 1.00
IGL01072:Dnmt3l APN 10 78052771 missense probably benign 0.09
IGL01118:Dnmt3l APN 10 78057286 missense probably damaging 0.97
IGL01553:Dnmt3l APN 10 78063248 missense probably benign 0.00
IGL02322:Dnmt3l APN 10 78052738 missense possibly damaging 0.90
IGL02323:Dnmt3l APN 10 78063318 missense probably damaging 1.00
IGL02618:Dnmt3l APN 10 78054022 splice site probably benign
IGL02701:Dnmt3l APN 10 78055022 missense probably benign 0.01
IGL02950:Dnmt3l APN 10 78050951 missense probably benign 0.01
R0318:Dnmt3l UTSW 10 78055055 missense probably damaging 1.00
R0384:Dnmt3l UTSW 10 78052737 missense possibly damaging 0.95
R0391:Dnmt3l UTSW 10 78051916 splice site probably benign
R1144:Dnmt3l UTSW 10 78051905 missense probably damaging 1.00
R2069:Dnmt3l UTSW 10 78052732 missense probably damaging 1.00
R2115:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2116:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2117:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R4812:Dnmt3l UTSW 10 78057294 missense probably benign 0.06
R5001:Dnmt3l UTSW 10 78059731 missense probably null 1.00
R5039:Dnmt3l UTSW 10 78052900 splice site probably null
R5389:Dnmt3l UTSW 10 78056831 splice site probably null
R5799:Dnmt3l UTSW 10 78052026 missense possibly damaging 0.71
R5811:Dnmt3l UTSW 10 78052095 missense possibly damaging 0.78
R5875:Dnmt3l UTSW 10 78053938 missense probably benign
R6537:Dnmt3l UTSW 10 78052064 missense probably null 1.00
R8437:Dnmt3l UTSW 10 78052768 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTTGATCAAAGTGGTCTCCAG -3'
(R):5'- TGACCAGTTCAGAGGCATGATC -3'

Sequencing Primer
(F):5'- GATCAAAGTGGTCTCCAGATTTTAC -3'
(R):5'- GAGTGATCATCATAATGAGTGTCCC -3'
Posted On2018-04-02