Incidental Mutation 'R6314:Zfp622'
ID509960
Institutional Source Beutler Lab
Gene Symbol Zfp622
Ensembl Gene ENSMUSG00000052253
Gene Namezinc finger protein 622
SynonymsZPR9, D15Ertd806e, 1110033B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location25984366-25998481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25986981 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000059678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061875]
Predicted Effect probably benign
Transcript: ENSMUST00000061875
AA Change: V273A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000059678
Gene: ENSMUSG00000052253
AA Change: V273A

DomainStartEndE-ValueType
ZnF_U1 1 35 2.42e-2 SMART
ZnF_C2H2 4 28 9.56e1 SMART
low complexity region 48 63 N/A INTRINSIC
ZnF_U1 66 100 2.02e-1 SMART
ZnF_C2H2 69 93 3.24e0 SMART
low complexity region 195 223 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 251 274 5.54e1 SMART
ZnF_C2H2 302 329 1.43e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000226884
AA Change: V62A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227912
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Zfp622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Zfp622 APN 15 25987200 missense probably damaging 1.00
R0144:Zfp622 UTSW 15 25991579 splice site probably benign
R0534:Zfp622 UTSW 15 25984568 missense possibly damaging 0.82
R4484:Zfp622 UTSW 15 25987051 splice site probably null
R4543:Zfp622 UTSW 15 25991537 missense possibly damaging 0.93
R4792:Zfp622 UTSW 15 25987042 nonsense probably null
R5388:Zfp622 UTSW 15 25996199 missense possibly damaging 0.80
R5424:Zfp622 UTSW 15 25984769 missense probably damaging 1.00
R7823:Zfp622 UTSW 15 25984623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAAGATATTGATTCCGATGATG -3'
(R):5'- TTTCTCATTGCACCACAAGC -3'

Sequencing Primer
(F):5'- TGGATTGGAATGTGAGGACCC -3'
(R):5'- CTCCTGGTCATGTGGAAATAATATG -3'
Posted On2018-04-02