Incidental Mutation 'R6314:Epb41l4a'
ID509967
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33874155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably damaging
Transcript: ENSMUST00000025234
AA Change: V261A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: V261A

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Meta Mutation Damage Score 0.4136 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTCTGCCTGGAAAGGTTTG -3'
(R):5'- TCCTCCACAGTATAAAGGAGCC -3'

Sequencing Primer
(F):5'- TCTTCTGCGAAAAGTGAAATGACACC -3'
(R):5'- GTATAAAGGAGCCTGCACTTCTC -3'
Posted On2018-04-02